ДНК НАНОМЕХАНИЧЕСКИЕ РОБОТЫ И ВЫЧИСЛИТЕЛЬНЫЕ УСТРОЙСТВА В.Ю. Попов Уральский государственный университет им. А.М. Горько...
11 downloads
241 Views
1MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
ДНК НАНОМЕХАНИЧЕСКИЕ РОБОТЫ И ВЫЧИСЛИТЕЛЬНЫЕ УСТРОЙСТВА В.Ю. Попов Уральский государственный университет им. А.М. Горького 620083, г. Екатеринбург, пр. Ленина, д. 51
Аннотация.
Одним
из
основных
компонентов
для
биомолекулярных
нанотехнологий является ДНК – молекула с физическими свойствами, которые делают ее идеальной основой как для конструирования на наноуровне, так и для хранения информации. Поэтому естественно, что ученые ищут пути для использования ДНК для создания нанобионических устройств. В частности, исследователи ищут пути использования
преимуществ
наномеханических
свойств
ДНК.
Данная
статья
посвящена обзору последних достижений в области ДНК наномеханической робототехники и разработки ДНК наномеханических вычислительных устройств.
Annotation. One of the primary components of all biomolecular nanotechnology is DNA, a molecule with physical properties that make it ideal for both nanoscale construction and information storage. Thus, it is natural that scientists are finding ways to use DNA for biomimetic control systems. In particular, researchers are learning to take advantage of the nanomechanical properties of DNA. This paper focuses on the state of the art in the field of DNA nanomechanical robotics and development of DNA nanomechanical computing devices.
1
Введение В 1959 году Фейнман выступил с докладом ―There‘s Plenty of Room at the Bottom‖ (см. [1], [2]), посвященным миниатюризации до уровня наночастиц. Позднее в работах [3], [4] был дан обстоятельный анализ возможных перспектив исследований в области нанотехнологий. В частности, в [3] было введено разделение на top–down (сверху вниз) и bottom–up (снизу вверх) технологии. Отличительной особенностью этих технологий должно быть то, что в рамках top–down технологий для получения продуктов, содержащих какие-либо изменения на уровне наночастиц, осуществляется управляющее воздействие из макромира, а в рамках bottom–up технологий для изготовления таких продуктов должно применяться управляющее воздействие из наномира. Естественно для того, чтобы добиться начала поступления требуемого управляющего воздействия из наномира, какие-то начальные воздействия необходимо осуществить
из
макромира.
Однако
возможности
таких
воздействий
весьма
ограничены. В частности, в области микропроцессоров существующие технологии уже дошли до уровня наночастиц [5] и существует мнение, что в обозримом будущем эти технологии достигнут своего предела [6]. Таким образом, хотя определенных изменений на уровне наночастиц можно добиться и современными технологиями, и даже средневековыми (булатная сталь, цветное стекло и т.д.), существенного прорыва следует ожидать от технологий, максимально переносящих управление в наномир. На сегодняшний день перспективу
существует
развития
ряд
документов, характеризующих обозримую
нанотехнологий.
Например,
Дорожная
карта
развития
нанотехнологий, составленная корпорацией RAND (Research And Development, США), Дорожная карта Европейской комиссии (Nanoroadmap Medical and Health, 2006 г.), созданная в рамках подготовки и реализации Седьмой рамочной программы Европейского Союза по научно-исследовательскому и технологическому развитию. В частности, созданная в 2001 году в США National Nanotechnology Initiative (NNI) определила следующую стратегию развития нанотехнологий [7] на 20 лет:
до 2004 года – создание пассивных наноструктур: наночастиц, саноструктурированных материалов, полимеров, керамики и т.д.;
2
до 2010 года – создание активных наноструктур: транзисторов, усилителей, силовых приводов, адаптивных структур и т.д.;
с 2010 года – создание систем наносистем: роботов, систем управления самоорганизацией и т.д.;
с
2020
года
–
создание
молекулярных
систем,
являющихся
интегрированными самостоятельно эволюционирующими системами для создания молекулярных роботов. Этот план достаточно наглядно отражает основную задачу, стоящую перед нанотехнологиями в обозримом будущем: наноструктурные изменения должны осуществляться нанороботами, которые производятся на нанозаводах-роботах. До сих пор нанотехнологии опирались преимущественно на достижения в области физики, химии, науки о материалах, биологии. При этом информационные технологии выступали лишь как вспомогательный инструмент, использующийся в рамках только что перечисленных наук. Однако решение основной задачи, стоящей перед нанотехнологиями, потребует от информационных технологий существенно большего: технологии, позволяющей осуществлять автономное управление крупномасштабными нанокомплексами посредством нанокомпьютеров. Степень успешности и скорость решения этой задачи естественным образом зависит от понимания того, что из себя будут представлять нанороботы и нанокомпьютеры, какова их принципиальная основа и какие конкретные задачи они будут решать. Однозначно ответить на эти вопросы в настоящий момент ответить достаточно сложно, поскольку нанотехнологии пока не готовы предложить какие-либо промышленные решения в этой области. Однако наиболее вероятным представляется прорыв в области биологических нанороботов и вычислительных устройств. Эта точка зрения базируется, во-первых, на том, что Природа уже создала существенный задел в области нанобиотехнологий (см., в частности, [8], [9]), во-вторых, на существенных достижениях молекулярной биологии, в-третьих, на том, что именно такие устройства имеют естественную адаптацию к интеграции с живыми системами на наноуровне. Кроме того, такая точка зрения подкрепляется тем, что нанобиотехнологии уже сейчас существенно опережают другие области нанотехнологий. В частности, если для нанотехнологий в целом переход на создание систем наносистем только ожидается, то
3
в рамках нанобиотехнологий этот этап уже наступил. Особенно интересным представляется направление ДНК наномеханических устройств, поскольку в этой области
созданы
не
только
отдельные
вычислительных устройств, но и
лабораторные
образцы
роботов
и
технология нанорешеток, позволяющая в
значительной степени перенести разработку наноустройств с дорогостоящего лабораторно-эксперементального уровня на уровень теоретических исследований и компьютерного моделирования. Литература
1.
Feynman R.P. There's plenty of room at the bottom // Eng. sci. Feb. 1966. V.23. P.22-26.
2.
http://www.zyvex.com/nanotech/feynman.html.
3.
Drexler K.E. Engines of Creation: The Coming Era of Nanotechnology, Anchor Press, 1986.
4.
Drexler K.E. Peterson C., Pergamit G. Unbounding the future: The nanotechnology revolution, 1991.
5.
Whitesides G.M., Love J.C. The Art of Building Small // Scientific American. September. 2001.
6.
http://science.howstuffworks.com/nanotechnology2.htm.
7.
http://www.nsf.gov/crssprgm/nano/reports/nnipres.jsp.
8.
Watson J.D., Crick F.H.C. A structure for Deoxyribose Nucleic Acid // Nature. 1953. V.171. P.737.
9.
Seeman N.C. The Use of Branched DNA for Nanoscale Fabrication // Nanotechnology. 1991. V.2. P.149-159.
4
1. Биологические предпосылки для построения ДНК наномеханических роботов и вычислительных устройств Еще в 1869 году Иоганном Фридрихом Мишером были обнаружены нуклеиновые кислоты. К началу XX века установили, что в молекулах нуклеиновой кислоты встречаются преимущественно пять нуклеотидов: аденин (A), тимин (T), цитозин (C), гуанин (G) и урацил (U). В 20-е годы XX века нуклеиновые кислоты были разделены на две группы: ДНК – дезоксирибонуклеиновая кислота; РНК – рибонуклеиновая кислота. В 1820 году Анри Бракон идентифицировал первую аминокислоту – глицин. К началу XX века все двадцать аминокислот были обнаружены, а их химическая структура описана. В начале XX века Эмиль Герман Фишер показал, что аминокислоты образуют белки. Таким образом, к началу ХХ века были
установлены
все три
основные группы молекул,
«ответственных» за
существование жизни. К середине ХХ века удалось выяснить, каким образом основные функции по поддержанию жизни распределены между ДНК, РНК и белками. В 1944 году Освальд Эйвери доказал, что гены располагаются в ДНК. Структура ДНК обеспечивает две важнейшие функции: кодирование белков и самоудвоение. Закодированная в ДНК информация определяет набор белков, доступных для синтеза, а процесс самоудвоения обеспечивает присутствие точных копий молекулы ДНК в новых клетках, а значит, стабильность вида. Существуют две основные группы белков: белки, используемые в качестве структурного материала клетки, и катализаторы (ферменты). Ферменты определяют какие именно химические реакции должны протекать в клетке и устанавливают интенсивность этих реакций. Молекулы РНК являются основным механизмом, обеспечивающим считывание информации с ДНК и синтез белков. Существует несколько десятков групп молекул РНК, имеющих различные функции. К основным следует отнести молекулы, осуществляющие идентификацию участков ДНК, содержащих информацию фиксированного типа, разрезание ДНК на части, соединение нескольких молекул ДНК в одну, считывание информации с ДНК, транспортировку, временное хранение информации, сборку белков. Имеются также молекулы РНК,
5
выполняющие функции ферментов и являющиеся источниками энергии для различных химических реакций. Рассматривая химические реакции, происходящие в клетке, по модулю нуклеотидов и аминокислот, мы наблюдаем функционирование механического вычислительного устройства, осуществляющего считывание информации с молекулы ДНК, расшифровку этой информации и формирование результата в виде новых молекул (ДНК, РНК и белков), в виде нового взаимного расположения уже имеющихся молекул или в виде модификации формы молекул. В каждой живой клетке располагается
миниатюрный
механический
вычислитель,
способный
решать
сложнейшие задачи с высокой скоростью и высокой степенью надежности. В последние десятилетия генетические последовательности были объектом весьма
интенсивного
изучения,
стимулировавшегося
преимущественно
исследованиями вокруг проекта «Геном человека» (см., например, [1], [2]). На сегодняшний день уже известны полные генетические последовательности достаточно большого количества организмов (см., например, [3], [4]). Кроме того, хотя геном человека еще не полностью изучен, уже есть достаточно большой биологический материал для того, чтобы проводить сравнительные исследования. Это дает возможность для детального изучения генетических особенностей конкретных организмов и сравнительного анализа биологических последовательностей различных организмов (см., например, [5] – [7]). В частности, это дает возможность изучать связи структуры биологических последовательностей и их функций посредством построения моделей (см., например, [8] – [12]). Отметим, что некоторые биологические базы данных поддерживают автоматическое создание моделей (см., например, [12], [13]). Существенные продвижения в области молекулярной биологии обеспечили достаточный
фундамент
для
того,
чтобы
взглянуть
на
генетические
последовательности не только как на объект изучения, но и как на материал для разработки различных устройств. Хотя на сегодняшний день молекулярная биология еще не достигла того уровня, который бы позволял полностью контролировать клетку и управлять ею, отдельные механические процессы уже достаточно хорошо изучены и могут быть использованы при разработке новых устройств. К числу таких процессов прежде всего относятся:
6
процесс
образования
слабых
связей,
основанный
на
принципе
комплементарности Уотсона – Крика;
процессы рестрикции и гибридизации;
белковые механические процессы.
Процесс
образования
слабых
связей,
основанный
на
принципе
комплементарности Уотсона – Крика. В 1950 году Эрвин Кирхгоф обнаружил, что между нуклеотидами существует определенная зависимость. В частности, существует взаимнооднозначное соответствие между количеством вхождений в ДНК аденина и тимина, цитозина и гуанина. В 1951 году Морис Вилкинс и Розалинда Франклин, изучая внешний вид ДНК, высказали предположение, что ДНК – это спиралевидная молекула. В 1953 году Джеймс Уотсон и Фрэнсис Крик совместили эти два открытия, что позволило им создать модель молекулы ДНК. Согласно модели Уотсона – Крика ДНК обычно образует спираль из двух нитей нуклеотидов. В каждой нити нуклеотиды соединены сильными связями. Нуклеотиды – как из одной нити, так и из разных – склонны также образовывать слабые связи. Нуклеотиды делятся на две группы: пурины и пиримидины. Пурины – это аденин и гуанин, а пиримидины – это тимин и цитозин. При этом A взаимодействует с T, а C – с G. Связь C – G сильнее, чем A – T. Пары C – G и A – T называют комплементарными, а нуклеотиды входящие в них парными. Последовательность Y[1] Y[2] … Y[n] называется комплементарной последовательности X[1] X[2] … X[n], если для любого i из множества
{1, 2, …, n} нуклеотиды X[i] и Y[i] образуют
комплементарную пару. В модели Уотсона – Крика стандартный вид ДНК – это спираль из двух последовательностей комплементарных друг другу. Таким образом, в модели Уотсона – Крика одна последовательность полностью определяется другой и их
7
взаимное расположение строго задано, т.е. без ограничения общности ДНК можно рассматривать просто как слово в четырехбуквенном алфавите. Однако строгое соответствие между последовательностями в молекуле ДНК является по большому счету лишь модельным допущением. В реальности молекулы ДНК весьма редко принимают именно такой вид. Однако они стремятся принять именно такой вид. В качестве
механизма,
объясняющего
это
стремление,
используется
принцип
минимизации свободной энергии. Согласно этому принципу каждый нуклеотид имеет три степени свободы. Две степени свободы предназначены для образования сильных связей, а третья – для связи. Если хотя бы одна степень свободы не участвует в связи, то нуклеотид обладает свободной энергией. Свободная энергия необразованных сильных связей существенно больше свободной энергии комплементарных связей. Для последовательности с уже сформированными сильными связями общая свободная энергия является суммой свободных энергий отдельных некомплементарных участков. Энергия некомплементарного участка определяется экспериментально (см., например, [14] – [16]). Она зависит от типа некомплементарного участка, его размеров и от последовательности
нуклеотидов,
образующей
некомплементарный
участок.
Молекулы, обладающие ненулевой свободной энергией, стремятся к уменьшению этой энергии за счет образования новых комплементарных связей. Слабые связи нестабильны. Поэтому в процессе минимизации свободной энергии может произойти разрыв уже существующих слабых связей, если новая конфигурация слабых связей обеспечивает меньшую свободную энергию. Использование этого принципа позволяет перемещать цепочки нуклеотидов за счет их внутренней свободной энергии, не привлекая какую-либо внешнюю энергию. В отличие от молекулы ДНК молекула РНК представляет собой одиночную последовательность нуклеотидов (A, U, C, G). Как и в молекуле ДНК, в молекуле РНК нуклеотиды склонны образовывать комплементарные пары. При этом формирование слабых связей подчиняется принципу минимизации свободной энергии. Поскольку РНК представляет собой одинарную последовательность,
а не
двойную, в живых организмах явления, связанные с минимизацией энергии для РНК встречаются существенно чаще, чем для ДНК. Соответственно для молекул РНК существенно выше их биологическая роль. Поэтому они лучше изучены.
8
Взаимосвязь между структурами биополимеров и РНК, образованными сильными и слабыми связями, является одним из основных объектов изучения современной биохимии и молекулярной биологии (см., например, [17]). Трехмерная структура имеет принципиально важное значение для многих разновидностей РНК (см., например, [18]). При этом задачи предсказания трехмерной структуры для РНК можно решать более точно, что позволяет строить высоко детализированные компьютерные модели для описания различных аспектов соотношения «структура сильных связей – структура комплементарных связей – функции» (см., например, [19]). Исследование трехмерных структур РНК обычно строится на базе двумерных. Отметим, что на сегодняшний день имеется несколько существенно различных моделей для вычисления свободной энергии (см., например, [20] – [23]). Процессы рестрикции и гибридизации. У эукариот ген, который кодирует белок, обычно построен из чередующихся экзонов и интронов. Экзоны – это экспрессируемые последовательности в гене, т.е. последовательности, которые, собственно, и кодируют белок. Интроны – это перемежающие последовательности, т.е. последовательности, которые в коде белка не участвуют. Число экзонов (а, следовательно, и интронов) обычно невелико. Количество генов существенно зависит от вида организмов (см., например, [24]). Считается, что все белки, расшифрованные к настоящему времени, составлены всего из нескольких тысяч экзонов (см., в частности, [25] – [27]). Отправной точкой белкового синтеза является так называемый процесс рестрикции. Процесс рестрикции – это химическая реакция, в результате которой из молекулы ДНК вырезаются участки, кодирующие белок. Синтез белка, кодируемого геном, происходит по следующей (несколько упрощенной) схеме. Сначала на матрице ДНК гена транскрибируется молекула РНК. При этом соблюдается условие комплементарности. Образующаяся в результате транскрипции РНК покрывает весь ген. Затем в транскрипте находятся границы интронов и экзонов. В соответствии с этими
границами
соответствующая
интронам
часть
РНК
вырезается,
а
соответствующие экзонам участки РНК гибридизируются (соединяются вместе) (см. [28]). Получающаяся молекула РНК называется матричной РНК и обозначается mРНК. mРНК покидает ядро клетки и используется для синтеза закодированного в ней белка.
9
Каждая клетка, как правило, содержит копию всех хромосом и, следовательно, всех генов целого организма, хотя в клетке экспрессируется только малая часть генов. Это значит, что только малая доля белков, закодированных в геноме, на самом деле производится в каждой конкретной клетке. Выполнимость такого ограничения обусловлена тем, что для успешной рестрикции и последующей гибридизации необходимы ферменты и вспомогательные молекулы РНК. Для различных реакций рестрикции и гибридизации требуются разные ферменты и вспомогательные молекулы РНК. Наличие или отсутствие соответствующих молекул в клетке определяет то, какие именно реакции происходят. Таким образом, управление рестрикцией и гибридизацией осуществляется
локально.
Это
позволяет,
регулируя
в
клетке
количество
вспомогательных молекул, управлять данными реакциями из вне и добиваться того, чтобы происходили только нужные нам реакции. Белковые механические процессы. Исследования белков позволили выявить ряд интересных механических процессов, возникающих при взаимодействии белковых структур.
В
частности,
для
осуществления
некоторых
белковых
процессов
используются белковые моторы. Один из таких примеров доставляет синтез ATP. Синтез ATP осуществляется при помощи фермента ATP Synthase. Установлено, что фермент ATP Synthase представляет собой механическое устройство, образованное двумя совместно работающими моторами (см. [29] – [32]). Соответственно синтез ATP осуществляется при помощи механической энергии, сообщаемой роторным мотором фермента ATP Synthase [33]. Кроме роторных моторов фермента ATP Synthase, обнаружены также белковые моторы, обеспечивающие прямолинейное движение. Эти моторы используются для доставки грузов, необходимых для функционирования белков [34]. На сегодняшний день известно несколько сотен таких моторов, встречающихся в различных семействах белков [35]. Эти моторы расположены в различных частях клетки и существенно отличаются по своим функциям [36]. Некоторые из этих моторов осуществляют сложные действия, состоящие из нескольких сотен шагов, а некоторые предназначены для выполнения одиночных действий [37] – [39]. Белковые моторы существенно различаются не только по своим действиям, но и по массе [40]. В настоящее время активно изучаются белковые моторы линейного движения, относящиеся к трем
10
большим семействам белков: Myosin (см. [41] – [69]), Kinesin (см. [40], [70] – [82]), Dynein (см. [83] – [97]). Белок Myosin известен молекулярным биологам с 1864. Его строение было изучено в 50-х годах ХХ века при помощи электронного микроскопа (см. [43] – [43]). Несколько позднее было установлено использование механической энергии в процессе функционирования белка [46], [47]. По сути дела Myosin представляет собой простейшую механическую руку, осуществляющую один цикл по перемещению и выходящую из процесса движения. Важно отметить, что один и тот же белок может несколько раз принимать участие в процессе движения. К сожалению, пока нет разумного объяснения тому, что принуждает белок принимать участие в движении. Не известно и какого-либо внешнего стимулятора.
Белок Kinesin можно
рассматривать как робот, располагающий двумя конечностями, при помощи которых он идет по направляющей. Направляющая является белковой последовательностью. Эта последовательность поляризована на концах, Kinesin движется по ней от отрицательного полюса к положительному. Важным свойством механических роботов, образованных белком Kinesin, является то, что эти роботы и соответственно их направляющие встречаются в клетке в большом количестве и используются в клетках многих типов. Белок Dynein образует существенно более сложное механическое устройство по сравнению с белками Myosin и Kinesin. Принцип действия этого устройства и его структура пока далеко не ясны изучены. Однако известно, что также как и Kinesin он представляет собой механическое устройство, осуществляющее движение по направляющей, но не от отрицательного полюса к положительному, а от положительного к отрицательному. В одноклеточных организмах, например, в Escherichia coli, Salmonella enterica serovar Typhimurium (Salmonella), Streptococcus, Caulobacter, Leptospira, Aquaspirrilum serpens, Bacillus встречается еще один интересный пример механических белковых устройств (см., [98] – [100]). Это группа механических роботов, которые перемещением своих конечностей обеспечивают процесс плаванья клетки. Размер этих роботов составляет примерно 45 нм в диаметре. Их деятельность обеспечивает жизненно важную функцию для клетки, поскольку перемещение их менее благоприятной среды в более благоприятную является одной из фундаментальных основ существования таких организмов как Escherichia coli. Известно, что основным приводящим
11
устройством у этих роботов является роторный двигатель [101], [102]. В состав этих роботов входит ряд дополнительных интересных механизмов. Например, счетчики частиц, измерительные приборы [103]. Процесс движения с использованием этих роботов довольно хорошо изучен [104] – [106]. Однако структура этих роботов еще плохо
изучена
[99].
Имеющиеся
модели
[107],
[108]
отталкиваются
от
экспериментально наблюдаемого феномена, а не от понимания строения этих роботов. На сегодняшний день изучение этих роботов сосредоточено преимущественно на выяснении того, из каких типов белков могут состоять такие роботы [109] – [115], а также того, каковы принципы взаимодействия, обеспечивающие работу этих устройств [116] – [122]. При этом известно, что типичный робот у состоит из примерно 20 различных белков [99]. Литература
1.
Cooper N. The human genome project. Mill Valley, CA: Univ. Science Books, 1994.
2.
Schuler G.D., Lander E.S., Hudson T.J. et al. A gene map for the human genome // Science. 1996. V.274. P.540-546.
3.
Fraser C.M., Casjens S., Huang W.M., Sutton G.G., Clayton R., Lathigra R., White O., Ketchum K.A., Dodson R., Hickey E.K., Gwinn M., Dougherty B., Tomb J.F., Fleischmann R.D., Richardson D., Peterson J., Kerlavage A.R., Quackenbush J., Salzberg S., Hanson M., van Vugt R., Palmer N., Adams M.D., Gocayne J., Venter J.C. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi // Nature. 1997. V.390. P.580-586.
4.
Fraser C.M., Norris S.J., Weinstock G.M., White O., Sutton G.G., Dodson R., Gwinn M., Hickey E.K., Clayton R., Ketchum K.A., Sodergren E., Hardham J.M., McLeod M.P., Salzberg S., Peterson J., Khalak H., Richardson D., Howell J.K., Chidambaram M., Utterback J., McDonald L., Artiach P., Bowman C., Cotton M.D., Venter J.C. Complete genome sequence of Treponema pallidum, the syphilis spirochete // Science. 1998. V.281. P.375-388.
12
5.
Das R., Hegyi H., Gerstein M. Genome analyses of spirochetes: a study of the protein structures, functions and metabolic pathways in Treponema pallidum and Borrelia burgdorferi // J. Mol. Microbiol. Biotechnol. 2000. V.2. N4. P.387-392.
6.
Gerstein M. Patterns of protein-fold usage in eight microbial genomes: a comprehensive structural census // Proteins. 1998. V.33. P.518-534.
7.
Wolf Y.I., Brenner S.E., Bash P.A., Koonin E.V. Distribution of protein folds in the three superkingdoms of life // Genome Res. 1999. V.9. P.17-26.
8.
Altschul S.F., Koonin E.V. Iterated profile searches with PSI-BLAST – a tool for discovery in protein databases // Trends in Biochem. Sci. 1998. V.23. P.444-447.
9.
Altschul S.F., Madden T.L., Schaffer A.A., Zhang J., Zhang Z., Miller W., Lipman D.J. Gapped BLAST and PSI-BLAST: a new generation of database programs // Nucleic Acids Res. 1997. V.25. P.3389-3402.
10.
Berman H.M., Westbrook J., Feng Z., Gilliland G., Bhat T.N., Weissing H., Shindyalov I.N., Bourne P.E. The Protein Data Bank // Nucleic Acids Res. 2000. V.28. P.235-242.
11.
Burley S.K., Almo S.C., Bonanno J.B., Capel M., Chance M.R., Gaastgerland T., Lin D., Sali A., Studier F.W., Swaminathan S. Structural genomics: beyond the Human Genome Project // Nature Genetics. 1999. V.23. P.151-157.
12.
Sanchez R., Pieper U., Mirkovic N., de Bakker P.I., Wittenstein E., Sali A. MODBASE, a database of annotated comparative protein structure models // Nucleic Acids Res. 2000. V.28. P.250-253.
13.
Guex N., Peitsch M.C. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling // Electrophoresis. 1997. V.18. P.27142723.
14.
Freier S.M., Kierzek R., Jaeger J.A., Sugimoto N., Caruthers M.H., Neilson T., Turner D.H. Improved free-energy parameters for prediction of RNA duplex stability // Proc. Natl. Acad. Sci. USA. 1986. V.83. P.9373-9377.
15.
Jaeger J.A., Turner D.H., Zuker M. Improved predictions of secondary structures for RNA // Proc. Natl. Acad. Sci. USA. 1989. V.86. P.7706-7710.
13
16.
Walter A.E., Turner D.H., Kim J., Lyttle M.H., Muller P., Mathews D.H., Zuker M. Co-axial stacking of helixes enhances binding of oligobonucleotides and improves predictions of RNA folding // Proc. Natl. Acad. Sci. USA. 1994. V.91. P.9218-9222.
17.
Draper D.E. Parallel worlds // Nature Struct. Biol. 1996. V.3. P.397-400.
18.
Westhof E., Jaeger L. RNA pseudoknots // Current Opinion Struct. Biol. 1992. V.2. P.327-333.
19.
Flamm C., Hofacker I.L., Stadler P.F. RNA In Silico. The Computational Biology of RNA Secondary Structures // Adv. Complex Syst. 1999. V.2. P.65-90.
20.
Waterman M., Smith T. Rapid dynamic programming methods for RNA secondary structure // Advances in Applied Mathematics. 1986. V.7. P.455–464.
21.
Nussinov R., Jacobson A.B. Fast algorithm for predicting the secondary structure of singlestranded RNA // Proceedings of the National Academy of Sciences of the United States of America. 1980. V.77. N.11. P.6309–6313.
22.
Tinoco I., Borer P.N., Dengler B., Levine M.D., Uhlenbeck O.C., Crothers D.M., Gralla J. Improved estimation of secondary structure in ribonucleic acids // Nature New Biology. 1973. V.246. P.40–41.
23.
Zuker M., Stiegler P. Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information // Nucleic Acids Research. 1981. V.9. P.133–148.
24.
Жимулев И.Ф. Современные представления о структуре гена у эукариот // Соросовский образовательный журнал. 2000. Т.6. N7. C.17-24.
25.
Dorit R.L., Gilbert W. The limited universe of exons // Current Opinions in Structural Biology. 1991. V.1. P.973-977.
26.
Patthy L. Exons – original building blocks of proteins? // BioEssays. 1991. V.13(4). P.187-192.
27.
Watson J., Oilman M., Witkowski J., Zoller M. Recombinant DNA. 2nd ed. San Fransisco, CA: Scientific American Books, 1992.
28.
Steitz J. Snurps // Scientific American. 1988 (June). P.56-63.
29.
Kinosita K., Jr., Yasuda R., Noji H., Adachi K. A rotary molecular motor that can work at near 100% efficiency // Philos. Trans.: Biol. Sci. 2000. V.355 (1396). P.473– 489.
14
30.
The Nobel Foundation. The Noble Prize in Chemistry 1997, April 10th, 2004. http://www.nobel.se/chemistry/educational/poster/1997/boyer-walker.html
31.
Crofts A. Lecture 10, ATP Synthase. University of Illinois at Urbana-Champaign. http://www.life.uiuc.edu/crofts/bioph354/lect10.html
32.
Lubert S. Biochemistry, 4th edition:W.H. Freeman and Company, 1995.
33.
Itoh H., Takahashi A., Adachi K., Noji H., Yasuda R., Yoshida M., Kinosita K., Jr. Mechanically driven ATP synthesis by F1-ATPase // Nature. 2004. V.427. P.465–468.
34.
Howard J. Molecular motors: structural adaptations to cellular functions // Nature. 1997. V.389. P.561–567.
35.
Vale R. Switches, latches, and amplifiers: common themes of G proteins and molecular motors // J. Cell Biol. 1996. V.135. P.291–302.
36.
Farrell C.M., Mackey A.T., Klumpp L.M., Gilbert S.P. The role of ATP hydrolysis for kinesin processivity // J. Biol. Chem. 2002. V.277. P.17079–17087.
37.
Block S.M., Goldstein L.S., Schnapp B.J. Bead movement by single kinesin molecules studied with optical tweezers // Nature. 1990. V.348. P.348–352.
38.
Howard J., Hudspeth A.J., Vale R.D. Movement of microtubules by single kinesin molecules // Nature. 1989. V.342. P.154–158.
39.
Finer J.T., Simmons R.M., Spudich J.A. Single myosin molecule mechanics: piconewton forces and nanometre steps // Nature. 1994. V.368. P.113–119.
40.
Block S.M. Kinesin,What Gives? // Cell. 1998. V.93. P.5–8.
41.
Sellers J.R. Myosins: a diverse superfamily. Biochimica et Biophys // Acta (BBA) — Mol. Cell Res. 2000. V.1496. P.3–22.
42.
Howard J. Molecular motors. Clamping own on myosin // Nature. 1994. V.368. P.98–99.
43.
Huxley H.E. The double array of filaments in cross-striated muscle // J. Biophys. Biochem. Cytol. 1957. V.3. P.631–648.
44.
Huxley H.E. Electron microscope studies of the organisation of the filaments in striated muscle // Biochimica et Biophys. Acta. 1953. V.12. P.387–394.
45.
Hanson J., Huxley H.E. Structural basis of the cross-striations in muscle // Nature. 1953. V.153. P.530–532.
15
46.
Huxley H.E. The mechanism of muscular contraction // Science. 1969. V.164. P.1356–1365.
47.
Lymn R.W., Taylor E.W. Mechanism of adenosine triphosphate hydrolysis by actomyosin // Biochemistry. 1971. V.10. P.4617–4624.
48.
http://sciencemag.org/feature/data/1049155.shl
49.
Lowey S., Slayter H.S., Weeds A.G., Baker H. Substructure of the myosin molecule. I. Subfragments of myosin by enzymic degradation // J. Mol. Biol. 1969. V.42. P.1–29.
50.
Weeds A.G., Lowey S. Substructure of the myosin molecule. II. The light chains of myosin // J. Mol. Biol. 1971. V.61. P.701–725.
51.
Wagner P.D., Giniger E. Hydrolysis of ATP and reversible binding to F-actin by myosin heavy chains free of all light chains // Nature. 1981. V.292. P.560–562.
52.
Citi S., Kendrick-Jones J. Regulation of non-muscle myosin structure and function // Bioessays. 1987. V.7. P.155–159.
53.
Sellers J.R. Regulation of cytoplasmic and smooth muscle myosin // Curr. Opin. Cell Biol. 1991. V.3. P.98–104.
54.
Schroder R.R., Manstein D.J., Jahn W., Holden H., Rayment I. et al. Threedimensional atomic model of F-actin decorated with Dictyostelium myosin S1 // Nature. 1993. V.364. P.171–174.
55.
Rayment I., Rypniewski W.R., Schmidt-Base K., Smith R., Tomchick D.R. et al. Threedimensional structure of myosin subfragment-1: a molecular motor // Science. 1993. V.261. P.50–58.
56.
Huxley A.F. Cross-bridge action: present views, prospects, and unknowns // J. Biomech. 2000. V.33. P.1189–1195.
57.
Huxley A.F., Simmons R.M. Proposedmechanism of force generation in striatedmuscle // Nature. 1971. V.233. P.533–538.
58.
Kabsch W., Mannherz H.G., Suck D., Pai E.F., Holmes K.C. Atomic structure of the actin: DNase I complex // Nature. 1990. V.347. P.37–44.
59.
Holmes K.C., Popp D., Gebhard W., Kabsch W. Atomic model of the actin filament // Nature. 1990. V.347. P.44–49.
60.
Spudich J.A. How molecular motors work // Nature. 1994. V.372. P.515–518.
16
61.
Baker J.E., Brust-Mascher I., Ramachandran S., LaConte L.E., Thomas D.D. A large and distinct rotation of the myosin light chain domain occurs upon muscle contraction // Proc. Natl. Acad. Sci. USA. 1998. V.95. P.2944–2949.
62.
Houdusse A., Kalabokis V.N., Himmel D., Szent-Gyorgyi A.G., Cohen C. Atomic structure of scallop myosin subfragment S1 complexed with MgADP: a novel conformation of the myosin head // Cell. 1991. V.97. P.459–470.
63.
Jontes J.D.,Wilson-Kubalek E.M., Milligan R.A. A 32 degree tail swing in brush border myosin I on ADP release // Nature. 1995. V.378. P.751–753.
64.
Veigel C., Coluccio L.M., Jontes J.D., Sparrow J.C.,Milligan R.A., Molloy J.E. The motor protein myosin-I produces its working stroke in two steps // Nature. 1999. V.398. P.530–533.
65.
Corrie J.E., Brandmeier B.D., Ferguson R.E.,TrenthamD.R., Kendrick-Jones J. et al. Dynamic measurement of myosin light-chain-domain tilt and twist in muscle contraction // Nature. 1999. V.400. P.425–430.
66.
Irving M., St Claire Allen T., Sabido-David C., Craik J.S., Brandmeier B. et al. Tilting of the light-chain region of myosin during step length changes and active force generation in skeletal muscle // Nature. 1995. V.375. P.688–691.
67.
Forkey J.N., Quinlan M.E., Shaw M.A., Corrie J.E., Goldman Y.E. Threedimensional structural dynamics of myosin V by single-molecule fluorescence polarization // Nature. 2003. V.422. P.399–404.
68.
Vale R.D., Milligan R.A. The way things move: looking under the hood of molecular motor proteins // Science. 2000. V.288. P.88–95.
69.
Kitamura K., Tokunaga M., Iwane A.H., Yanagida T. A singlemyosin headmoves along an actin filament with regular steps of ~5.3 nm // Nature. 1999. V.397. P.129– 134.
70.
Howard J. The movement of kinesin along microtubules // Annu. Rev. Physiol. 1996. V.58. P.703–729.
71.
Howard J., Hyman A.A. Dynamics and mechanics of the microtubule plus end // Nature. 2003. V.422. P.753–758.
72.
Hirokawa N. Kinesin and dynein superfamily proteins and the mechanism of organelle transport // Science. 1998. V.279. P.519–526.
17
73.
Vale R.D., Funatsu T., PierceD.W., Romberg L., HaradaY., Yanagida T. Direct observation of single kinesin molecules moving along microtubules // Nature. 1996. V.380. P.451–453.
74.
Berliner E., Young E.C., Anderson K., Mahtani H.K., Gelles J. Failure of a singleheaded kinesin to track parallel to microtubule protofilaments // Nature. 1995. V.373. P.718–721.
75.
Sablin E.P., Kull F.J., Cooke R., Vale R.D., Fletterick R.J. Crystal structure of the motor domain of the kinesin-related motor ncd // Nature. 1996. V.380. P.555–559.
76.
Sack S., Muller J., Marx A., Thormahlen M., Mandelkow E.M. et al. X-ray structure of motor and neck domains from rat brain kinesin // Biochemistry. 1997. V.36. P.16155–16165.
77.
Schnitzer M.J., Block S.M. Kinesin hydrolyses one ATP per 8-nm step // Nature. 1997. V.388. P.386–390.
78.
Peskin C.S., Oster G. Coordinated hydrolysis explains the mechanical behavior of kinesin // Biophys. J. 1995. V.68. P.202–211.
79.
Lohman T.M., Thorn K., Vale R.D. Staying on track: common features of DNA helicases and microtubule motors // Cell. 1998. V.93. P.9–12.
80.
Hackney D.D. Highly processive microtubule-stimulated ATP hydrolysis by dimeric kinesin head domains // Nature. 1995. V.377. P.448–450.
81.
Hunt A.J., Gittes F., Howard J. The force exerted by a single kinesin molecule against a viscous load // Biophys. J. 1994. V.67. P.766–781.
82.
Svoboda K., Block S.M. Force and velocity measured for single kinesin molecules // Cell. 1994. V.77. P.773–784.
83.
Gibbons I.R., Rowe A.J. Dynein: a protein with adenosine triphosphate activity from cilia // Science. 1965. V.149. P.424–426.
84.
Schroer T.A., Steuer E.R., Sheetz M.P. Cytoplasmic dynein is a minus enddirected motor for membranous organelles // Cell. 1989. V.56. P.937–946.
85.
Schnapp B.J., Reese T.S. Dynein is the motor for retrograde axonal transport of organelles // Proc. Natl Acad. Sci. USA. 1989. V.86. P.1548–1552.
86.
Lye R.J., Porter M.E., Scholey J.M., McIntosh J.R. Identification of a microtubulebased cytoplasmic motor in the nematode C. elegans // Cell. 1987. V.51. P.309–318.
18
87.
Paschal B.M., Shpetner H.S., Vallee R.B. MAP 1C is a microtubule-activated ATPase which translocates microtubules in vitro and has dynein-like properties // J. Cell Biol. 1987. V.105. P.1273–1282.
88.
Hirokawa N., Sato-Yoshitake R., Yoshida T., Kawashima T. Brain dynein (MAP1C) localizes on both anterogradely and retrogradely transported membranous organelles in vivo // J. Cell Biol. 1990. V.111. P.1027–1037.
89.
Waterman-Storer C.M., Karki S.B., Kuznetsov S.A.,Tabb J.S.,WeissD.G. et al. The interaction between cytoplasmic dynein and dynactin is required for fast axonal transport // Proc. Natl Acad. Sci. USA. 1997. V.94. P.12180–12185.
90.
Lin S.X., Collins C.A. Immunolocalization of cytoplasmic dynein to lysosomes in cultured cells // J. Cell. Sci. 1992. V.101 ( Pt 1). P.125–137.
91.
Corthesy-Theulaz I., Pauloin A., Rfeffer S.R. Cytoplasmic dynein participates in the centrosomal localization of the Golgi complex // J. Cell Biol. 1992. V.118. P.1333–1345.
92.
Aniento F., Emans N., Griffiths G., Gruenberg J. Cytoplasmic dynein-dependent vesicular transport from early to late endosomes // J. Cell Biol. 1993. V.123. P.1373– 1387.
93.
Fath K.R., Trimbur G.M., Burgess D.R. Molecular motors are differentially distributed on Golgi membranes from polarized epithelial cells // J. Cell Biol. 1994. V.126. P.661–675.
94.
Blocker A., Severin F.F., Burkhardt J.K., Bingham J.B., Yu H. et al. Molecular requirements for bi-directional movement of phagosomes along microtubules // J. Cell Biol. 1997. V.137. P.113–129.
95.
King S.J., Bonilla M., Rodgers M.E., Schroer T.A. Subunit organization in cytoplasmic dynein subcomplexes // Protein Sci. 2002. V.11. P.1239–1250.
96.
King S.M. The dynein microtubule motor // Biochim. Biophys. Acta. 2000. V.1496. P.60–75.
97.
Burgess S., Walker M.L., Sakakibara H., Knight P.J., Oiwa, K. Dynein Structure and Power Stroke // Nature. 2003. V.421. P.715–718.
98.
Berry R.M., Armitage J.P. The bacterial flagella motor // Adv. Microb. Physiol. 1999. V.41. P.291–337.
19
99.
Berg H.C. The rotary motor of bacterial flagella // Ann. Rev. Biochem. 2003. 72: 19–54.
100.
Blair D.F. How bacteria sense and swim // Annu. Rev. Microbiol. 1995. V.49.
P.489–522. 101.
Berg H.C., Anderson R.A. Bacteria swim by rotating their flagellar filaments //
Nature. 1973. V.245. P.380–382. 102.
Fahrner K.A., Ryu W.S., Berg H.C. Biomechanics: bacterial flagellar switching
under load // Nature. 2003. V.423. P.938. 103.
Berg H.C. Motile behavior of bacteria // Phys. Today. 2000. V.53. P.24–29.
104.
Scharf B.E., Fahrner K.A., Turner L., Berg H.C. Control of direction of flagellar
rotation in bacterial chemotaxis // Proc. Natl Acad. Sci. USA. 1998. V.95. P.201–206. 105.
Macnab R.M. Bacterial flagella rotating in bundles: a study in helical geometry //
Proc. Natl. Acad. Sci. USA. 1997. V.74. P.221–225. 106.
Elston T.C., Oster G. Protein turbines. I: The bacterial flagellar motor // Biophys.
J. 1997. V.73. P.703–721. 107.
Walz D., Caplan S.R. An electrostatic mechanism closely reproducing observed
behavior in the bacterial flagellar motor // Biophys. J. 2000. V.78. P.626–651. 108.
Schmitt R. Helix rotation model of the flagellar rotary motor // Biophys. J. 2003.
V.85. P.843–852. 109.
Iino T., Komeda Y., Kutsukake K., Macnab R.M., Matsumura P. et al. New
unified nomenclature for the flagellar genes of Escherichia coli and Salmonella typhimurium // Microbiol. Rev. 1988. V.52. P.533–535. 110.
Berg H.C. Dynamic properties of bacterial flagellar motors // Nature. 1974. V.249.
P.77–79. 111.
Ueno T., Oosawa K., Aizawa S. M ring, S ring and proximal rod of the flagellar
basal body of Salmonella typhimurium are composed of subunits of a single protein, FliF // J. Mol. Biol. 1991. V.227. P.672–677. 112.
Ueno T., Oosawa K., Aizawa S. Domain structures of the MS ring component
protein (FliF) of the flagellar basal body of Salmonella typhimurium // J. Mol. Biol. 1994. V.236. P.546–555.
20
113.
Driks A., DeRosier D.J. Additional structures associated with bacterial flagellar
basal body // J. Mol. Biol. 1990. V.211. P.669–672. 114.
Khan I.H., Reese T.S., Khan S. The cytoplasmic component of the bacterial
flagellar motor // Proc. Natl Acad. Sci. USA. 1992. V.89. P.5956–5960. 115.
Francis N.R., Sosinsky G.E., Thomas D., DeRosier D.J. Isolation, characterization
and structure of bacterial flagellar motors containing the switch complex // J.Mol. Biol. 1994. V.235. P.1261–1270. 116.
YorimitsuT., Homma M. Na+-driven flagellar motor of Vibrio // Biochimica et
Biophy. Acta (BBA)—Bioenerg. 1994. V.1505. P.82–93. 117.
Meister M., Lowe G., Berg H.C. The proton flux through the bacterial flagellar
motor // Cell. 1987. V.49. P.643–650. 118.
Van Way S.M., Hosking E.R., Braun T.F., Manson M.D. Mot protein assembly
into the bacterial flagellum: amodel based onmutational analysis of the motB gene // J.Mol. Biol. 2000. V.297. P.7–24. 119.
Blair D.F., Berg H.C. Restoration of torque in defective flagellar motors //
Science. 1988. V.242. P.1678–1681. 120.
Fung D.C., Berg H.C. Powering the flagellar motor of Escherichia coli with an
external voltage source // Nature. 1995. V.375. P.809–812. 121.
Berg H., Turner L. Torque generated by the flagellar motor of Escherichia coli //
Biophys. J. 1993. V.65. P.2201–2216. 122.
Chen X., Berg H.C. Torque-speed relationship of the flagellar rotary motor of
Escherichia coli // Biophys. J. 2000. V.78. P.1036–1041.
21
2. Основные тенденции в области разработки устройств с использованием генетического материала На сегодняшний день интенсивно развиваются два основные направления, направленные на создание ДНК-компьютеров и ДНК наномеханических устройств, соответственно. Первое связано с разработкой высокопроизводительного вычислителя, функционирующего в лабораторных условиях. Второе нацелено на создание устройств, способных функционировать в биологической среде. Хотя исследования в этих двух направлениях очень тесно связаны друг с другом, их целевые функции существенно различаются. Совершенно естественно, что создание вычислительной машины, использующей тем или иным способом генетический материал, на может быть самоцелью. Если уж создавать такую машину, то хотелось бы, чтобы она была лучше других вычислителей, в частности, желательно, чтобы она имела существенные вычислительные возможности. С другой стороны, даже очень примитивное с вычислительной точки зрения устройство, способное работать в живой клетке, может представлять существенный интерес. Например, сообщение «Создан компьютер, умеющий решать задачу поиска заданного образца в заданной строке», пожалуй, не вызвало бы у окружающих ничего, кроме улыбки… Однако добавка «Компьютер может функционировать в живой клетке» привела бы к настоящей революции в области диагностики наследственных заболеваний… В соответствие с этими различиями в целях можно говорить о различии задач при создании ДНК-компьютера и ДНК наномеханического вычислительного устройства: ДНК-компьютер должен превосходить по вычислительным возможностям другие типы вычислительных устройств, ДНК наномеханическое вычислительное устройство должно быть способно функционировать в биологической среде и пригодно для обеспечения управления ДНК наномеханическими роботами. Первым устройством, построенным при помощи генетического материала, был ДНК-компьютер Адлемана [1]. Эксперимент, поставленный Адлеманом, был направлен на создание высокопроизводительного вычислителя, который позволил бы решать алгоритмически трудные проблемы за разумное (полиномиальное) время. Эксперимент Адлемана выявил серьезные трудности на пути создания высокопроизводительного
22
вычислителя. Однако он доказал, что молекулярные вычисления возможны и обладают некоторыми существенными достоинствами по сравнению с другими технологиями. В рамках исследований по созданию ДНК-компьютеров получены весьма интересные теоретические результаты. В частности, разработаны теоретические модели ДНК-вычислений, в рамках которых значительно расширяется класс алгоритмических проблем, разрешимых за разумное время (см., например, [2] – [5]). Имеются существенные продвижения и в экспериментальной области. Например, гибридный чип исследовательской группы биомолекулярных информационных систем (BioMIP) Фраунгоферовского общества. Большое внимание исследователей сосредоточено на создании ДНК-чипов путем размещения на поверхности чипов предварительно синтезированных полинуклеотидов или отдельных мономеров с последующей гибридизацией (см. [6] – [30]). В частности, существенные продвижения получены в области точного позиционирования генетических последовательностей в пространстве, инструментов нанесения генетических последовательностей на поверхность чипа, возможности размещения разнообразных последовательностей (наиболее наглядный пример достижений в этой области можно найти в [31]). Однако на сегодняшний день модели ДНК-компьютеров, хорошо проявившие себя в рамках экспериментов, обладают довольно низким теоретическим потолком вычислительных возможностей. В значительной мере это объясняется тем, что как создание самих чипов, так и управление генетическим материалом осуществляется преимущественно при помощи внешнего управления. Другим существенным затруднением является алгоритмическая сторона используемой технологии. Дело в том, что конструирование генетических последовательностей, используемых в ДНК-чипах, основано на методе, называемом секвенсинг гибридизацией (sequencing by hybridization) (см. [32] – [35]). Этот метод активно изучается и используется (см. [36] – [41]). Он является на сегодняшний день основным лабораторным методом анализа и конструирования больших генетических последовательностей. В работе [42] предложен комплексный подход к изучению вычислительной
сложности
алгоритмических
проблем,
возникающих
при
использовании секвенсинга гибридизацией. А именно, в [42] сформулированы три основные проблемы SBH, SBH-ADD, SBH-DEL. Хотя проблема SBH решается за полиномиальное время, для практического использования секвенсинга гибридизацией
23
алгоритма, позволяющего решать только эту проблему, явно недостаточно, поскольку при работе с большими объемами генетического материала трудно полностью исключить возможность возникновения ошибок. Для надежного функционирования метода необходимы эффективные алгоритмы, позволяющие решать проблемы SBHADD и SBH-DEL. Для решения проблемы SBH-DEL эффективных алгоритмов пока неизвестно. Неизвестна и трудность этой проблемы. Для проблемы SBH-ADD в работе [43] установлено, что она является NP-полной. Поэтому
не следует надеяться на
нахождение быстрого алгоритма, решающего эту проблему в общем случае (некоторые эффективные алгоритмы для решения этой проблемы предложены в [44]). У моделей, предполагающих значительное увеличение производительности, имеются серьезные трудности с точки зрения практической реализации, которые, как правило, связаны с невозможностью осуществлять достаточно надежный контроль за процессами, происходящими в генетической жидкости. И в том, и в другом случаях явно прослеживается связь с недостаточной эффективностью использования генетического материала. В связи с этим на современном этапе направление по созданию ДНК наномеханических устройств представляется актуальным не только с точки зрения возможности функционирования в живых клетках, но и потому, что именно оно может вывести на создание устройств, способных функционировать непосредственно в генетической жидкости ДНК-компьютеров и нацеленных на оптимизацию ее использования. Литература
1.
Adleman L.M. Molecular computation of solutions to combinatorial problems // Science. 1994. V.266, 1021-1024.
2.
Lipton R.J. Speeding up computations via molecular biology. Technical report, Princeton University, 1994.
3.
Lipton R.J. Using DNA to solve NPcomplete problems. Technical report, Princeton University, 1995.
4.
Pudlak P. Complexity theory and genetics. In: Proceedings of 9th Conference on Structure in Complexity Theory, 1994. P.183-195.
24
5.
Попов В.Ю. Полугрупповые модели процесса рестрикции. Международная алгебраическая
конференция,
университета и
посвященная
250-летию
Московского
75-летию кафедры высшей алгебры. Тезисы
докладов.
Москва, 2004. С.108. 6.
Schasfoort R., Schlautmann S., Hendrikse S., van den Berg A. Field-effect flow control for microfabricated fluidic networks // Science. 1999. V.286. P.942-945.
7.
Ni J., Zhong C., Coldiron S., Porter M. Electrochemically actuated mercury pump for fluid flow and delivery // Analytical Chemistry. 2001. V.73. P.103-110.
8.
Gallardo B., Gupta V., Eagerton F., Jong L., Craig V., Shah R., Abbott N. Electrochemical principles for active control of liquids on submillimeter scales. // Science. 1999. V.283. P.57-60.
9.
Ichimura K., Oh S., Nakagawa M. Light-driven motion of liquids on a photoresponsive surface. // Science. 2000. V.288. P.1624-1626.
10.
Weiler J., Hoheisel J. Combining the preparation of oligonucleotide arrays and synthesis of high-quality primers // Analytical Biochemistry. 1996. V.243. P.218-227.
11.
Bras M., Cloarec J., Bessueille F., Souteyrand E., Martin J., Chauvet J. Control of immobilization and hybridization on DNA chips by fluorescence spectroscopy // Journal of Fluorescence. 2000. V.10. N3. P.247-253.
12.
Pease A., Solas D., Sullivan E., Cronin M., Holmes C., Fodor S. Light-generated oligonucleotide arrays for rapid DNA sequence analysis // Proc. Natl. Acad. Sci. USA. 1994. V.91. P.5022-5026.
13.
McGall G., Barone A., Diggelmann M., Fodor S., Gentalen E., Ngo N. The efficiency of light-directed synthesis of DNA arrays on glass substrates // J. Am. Chem. Soc. 1997. V.119. P.5081-5090.
14.
Case-Green S., Mir K., Pritchard C., Southern E. Analysing genetic information with DNA arrays // Current Opinion in Chemical Biology. 1998. V.2. P.404-410.
15.
Lipshutz R., Fodor S., Gingeras T., Lockhart D. High density synthetic oligonucleotide arrays // Nature genetics supplement. 1999. V.21. P.20-24.
16.
Le Proust E., Pellois J., Yu P., Zhang H., Gao X. Digital light-directed synthesis. A microarray platform that permits rapid reaction optimization on a combinatorial basis // Journal of Combinatorial Chemistry. 2000. V.2. P.349-354.
25
17.
Kelley S., Boon E., Barton J., Jackson N., Hill M. Single-base mismatch detection based on charge transduction through DNA // Nucleic Acids Research. 1999. V.27. P.4830-4837.
18.
Roget A., Livache T. In situ synthesis and copolymerization of oligonucleotides on conducting polymers // Mikrochimica Acta. 1999. V.131. P.3-8.
19.
Singh-Gasson S., Green R., Yue Y., Nelson C., Blattner F., Sussman M., Cerrina F. Maskless fabrication of light-directed oligonucleotide microarrays using a digital micromirror array // Nature Biotechnology. 1999. V.17. N10. P.974-978.
20.
McGall G., Labadie J., Brock P., Wallraff G., Nguyen T., Hinsberg W. Lightdirected synthesis of high-density oligonucleotide arrays using semiconductor photoresists // Proc. Natl. Acad. Sci. USA. 1996. V.93. P.13555-13560.
21.
Kwiatkowski M., Fredriksson S., Isaksson A., Nilsson M., Landegren U. Inversion of in situ synthesized oligonucleotides: improved reagents for hybridization and primer extension in DNA microarrays // Nucleic Acids Research. 1999. V.27. N24. P.4710-4714.
22.
Sosnowski R., Tu E., Butler W., O‘Connell J., Heller M.Rapid determination of single base mismatch mutations in DNA hybrids by direct electric field control // Proc. Natl. Acad. Sci. USA. 1997. V.94. P.1119-1123.
23.
Westin L., Xu X., Miller C., Wang L., Edman C., Nerenberg M. Anchored multiplex amplification on a microelectronic chip array // Nature Biotechnology. 2000. V.18. N2. P.199-204.
24.
Zong Q., Schummer M., Hood L., Morris D. Messenger RNA translation state: the second dimension of high-throughput expression screening // Proc. Natl. Acad. Sci. USA. 1996. V.96. P.10632-10636.
25.
Schultz S., Smith D., Mock J., Schultz D. Single-target molecule detection with nonbleaching multicolor optical immunolabels // Proc. Natl. Acad. Sci. USA. 2000. V.97. N3. P.996-1001.
26.
Adessi C., Matton G., Ayala G., Turcatti G., Mermod J., Mayer P., Kawashima E. Solid phase DNA amplification: characterisation of primer attachment and amplification mechanisms // Nucleic Acids Research. 2000. V.28. N.20. P.87.
26
27.
Lucas S., Harding M. Detection of DNA via an ion channel switch biosensor // Analytical Biochemistry. 2000. V.282. P.70-79.
28.
Vo-Dinh T., Alarie J., Isola N., Landis D., Wintenberg A., Ericson M. DNA biochip using a phototransistor integrated circuit // Analytical Chemistry. 1999. V.71. P.358-363.
29.
van Gijlswijk R., Zijlmans H., Wiegant J., Bobrow M., Erickson T., Adler K., Tanke H., Raap A. Fluorochrome-labeled tyramides: use in immunocytochemistry and fluorescence in situ hybridization // The Journal of Histochemistry & Cytochemistry. 1997. V.45. N3. P.375-382.
30.
Ichimura K. Photoalignment of liquid-crystal systems // Chemical Reviews. 2000. V.100. P.1847-1873.
31.
Rodolfa K.T. et al. Nanopipette paints DNA picture // Angew. Chem. Int. Ed. 2005. V.44.
32.
Drmanac R., Crkvenjakov R. 1987. Method of sequencing of genomes by hybridization of oligonucleotide probes. Yugoslav patent application 570/80.
33.
Drmanac R., Labat I., Brukner L., Crkvenjakov R. Sequencing of megabase plus DNA by hybridization: Theory and method // Genomics. 1989. V.4. P.114-128.
34.
Лысов Ю.П., Флорентьев В.Л., Хорлин А.А., Храпко К.Р., Шик В.В., Мирзабеков А.Д.
Определение нуклеотидной последовательности ДНК
гибридизацией с олигонуклеотидами. Новый метод // Доклады Академии Наук СССР. 1988. 35.
Bains W., Smith G.C. A novel method for nucleic acid sequence determination // J. Theor. Biol. 1988. V.135. P.303-307.
36.
Pevzner P.A. Computational Molecular Biology: An Algorithmic Approach. MIT Press, 2000.
37.
Pevzner P.A., Lipshutz R.J. Towards DNA sequencing chips // Symposium on Mathematical Foundations of Computer Science. 1994. LNCS. V.841. P.143-158.
38.
Pevzner P.A., Lysov Yu.P., Khrapko K.R., Belyavsky A.V., Florentiev V.L., Mirzabekov A.D. Improved chips for sequencing by hybridization // J. Biomol. Struct. Dyn. 1991. V.9. P.399-410.
27
39.
Preparata F., Frieze A., Upfal E. Optimal reconstruction of a sequence from its probes // Journal of Computational Biology. 1999. V.6. N34. P.361-368.
40.
Preparata F., Upfal E. Sequencing by hybridization at the information theory bound: An optimal algorithm // Journal of Computational Biology. 2000. V.7. N34. P.621-630.
41.
Shamir
R.
Algorithms
in
molecular
biology:
Lecture
notes,
2001.
http://www.math.tau.ac.il/ rshamir/algmb/algmb00.html. 42.
Bodlaender H.L., Downey R.G., Fellows M.R., Hallett M.T., Wareham H.T. Parameterized complexity analysis in computational biology // Computer Applications in the Biosciences. 1995. V.11. P.49-57.
43.
Попов
В.Ю.
Вычислительная
сложность
проблем,
связанных
с
расшифровкой ДНК гибридизацией // Доклады Академии Наук. 2005. Т.403. N3. C.1-3. 44.
Попов В.Ю. О проблеме расшифровки ДНК гибридизацией // IX международная конференция "Интеллектуальные системы и компьютерные науки", 23-27 октября 2006, Москва. Т.1. С.216-217.
28
3. Материалы для создания ДНК наномеханических устройств На сегодняшний день существует довольно много различных моделей устройств на основе ДНК. Достаточно сказать, что только различных моделей вычислительных устройств существует несколько десятков (см., например, [1] – [52], см. также библиографию в [53], [54]). Значительная часть этих исследований основана на экспериментах,
проводившихся
с
существенно
различными
устройствами
из
генетического материала (см. [1], [2], [5], [9], [10], [12], [24], [28] – [30], [32] – [34], [36], [49], [51]). При этом в большинстве случаев конструктивными элементами устройств являются либо молекулы, заимствованные из естественной среды, либо молекулы, специально синтезированные для этих устройств, либо некоторые комбинации того и другого. Однако, начиная с самой первой конструкции, предложенной в [1], отчетливо прослеживается, пусть и не всегда полностью осознанная, тенденция к созданию не монолитных устройств, а устройств, собранных из отдельных деталей, имеющих свою функциональную нагрузку. В частности, в основе устройства, предложенного в [1], лежали молекулы двух видов, кодирующие ребра и вершины графа, соответственно. Эти молекулы формировали множество правильных и неправильных решений, которое проходило три этапа фильтрации. Эта конструкция допускает широкие возможности модификации. При этом во многих случаях результат модификации будет легко предсказуем, что открывает путь к теоретическому анализу конструкции и компьютерному моделированию. В частности, по вполне прозрачному закону могут быть заменены типы молекул. Могут подвергнуться изменению и процедуры фильтрации. В результате чисто теоретического анализа конструкции [1] возникла, в частности, весьма интересная модель, предложенная в [8], получившая дальнейшее экспериментальное развитие в [28]. Хотя устройства, рассматриваемые в [1], [8] и [28], состоят из весьма простых молекул, а процедуры фильтрации в рамках экспериментов имели биохимическую природу, с модельной точки зрения об этих устройствах вполне можно говорить как о собранных из деталей. Соответственно, можно ставить вопрос о разработке деталей для подобных устройств. Дальнейшим логическим развитием устройства из большого количества независимых элементов стала идея использования вместо отдельных молекул групп
29
молекул, эмулирующих автомат. В рамках этой идеи была предложена модель универсального вычислителя (см. [2], см. также [4], [55], [56]), а также устройство, которое может быть использовано в медицинских целях для контроля синтеза белков [3]. Автомат состоит из большой группы отдельных молекул, каждая из которых выполняет свою специфическую функцию. Совокупность этих молекул реализует автомат с двумя состояниями, двоичным входом и 765 синтаксически различными программами. Часть молекул, входящих в состав автомата, являются ферментами, обеспечивающими автомат энергией для взаимодействия его частей. Универсальный вычислитель представляет собой генетическую жидкость, в которую помещено большое количество одинаковых автоматов. На 1 мл генетической жидкости приходится 3 × 1012 автоматов, которые производят 6.6 × 1010 операций в секунду с точностью 99.9%. Хотя 0.1% - это сравнительно небольшая погрешность, для рассматриваемого вычислителя эта погрешность дает 6.6 × 107 ошибок на 1 мл за секунду. Одной из основных причин столь высокой погрешности при вычислениях является слишком большое количество различных конструктивных элементов в автомате, между которыми не установлены достаточно надежные связи. С этой точки зрения
существенно
более
предпочтительно
самоорганизующихся наноструктур,
выглядит
идея
использования
поскольку в рамках этой модели устройство
конструируется не как набор независимых молекул, а как единый механизм, в котором молекулы объединены при помощи межнуклеотидных связей. Идея использования самоорганизующихся структур для создания устройств была предложена в [20], а начало изучения таких структур было положено в работе [37]. А именно, в [37] была предложена идея создания искусственных молекул ДНК, которые являются стабильными (несклонными к разрушению или изменению формы) и могут быть объединены в стабильные молекулярные конструкции. Такие молекулы называют наноузлами, а получаемые из них конструкции – нанорешетками. Стабильность
наноузлов и
их
склонность
к
образованию
стабильных
молекулярных конструкций позволяют рассматривать наноузлы в качестве «фигурных кирпичей» и дает возможность выйти на принципиально новый уровень абстракции в исследованиях. В свое время обнаружение нуклеиновых кислот и аминокислот и
30
понимание того, что все генетические соединения получены из них и свойства генетического материала зависят только от них, позволило рассуждать по модулю нуклеотидов и аминокислот, не вдаваясь в их химическое устройство. Соответственно появление наноузлов дает возможность вести рассуждения по модулю этих новых структур. В работах [57] – [59] описаны исследования по наноузлам и нанорешеткам, не сохраняющим геометрическую форму. Благодаря исследованиям [60] – [70] удалось синтезировать нанорешетки, которые могут сохранять геометрическую структуру. Исследования [71] – [78] направлены на построение нанорешеток с сложной топологической структурой и разработку технологий, позволяющих из одинаковых нуклеотидных последовательностей получать нанорешетки с различной топологией. В частности, в рамках исследований, связанных с изменением топологической структуры
последовательностей
ДНК
и
РНК,
обнаружены
молекулы
DNA
topoisomerase, которые позволяют осуществлять такие изменения формы нанорешеток, которые невозможно осуществить без разрыва уже существующих связей (см. [74], [75]). К сожалению, на сегодняшний день нет какого-либо общего критерия, который позволял бы говорить о том, является ли та или иная последовательность ДНК топоизомеразой и если является, то какие топологические изменения она может стимулировать. Поэтому опираться в этом вопросе можно пока только на экспериментальные данные. Известно, что одни и те же молекулы DNA topoisomerase могут осуществлять топологические преобразования в несколько различных топологических форм. В частности, все взаимные преобразования между молекулами, представленные на рисунке 1, осуществляются при помощи Type I DNA topoisomerase [74].
31
Рис.1. Взаимные преобразования между молекулами, осуществляющиеся при помощи Type I DNA topoisomerase [74]. В одной и той же молекуле может быть несколько различных видов DNA topoisomerase. При этом некоторые из топологических преобразований могут быть выполнены только молекулами фиксированного типа. Например, преобразование, представленное на рисунке 2, может быть осуществлено при помощи E. coli DNA Topoisomerase III, но его нельзя выполнить при помощи E. coli DNA Topoisomerase I (см. [75]).
Рис.2. Топологическое преобразование, которое может быть осуществлено при помощи E. coli DNA Topoisomerase III, но нельзя выполнить при помощи E. coli DNA Topoisomerase I (см. [75]). Следует
отметить,
что,
хотя
многие
свойства
биологических
последовательностей можно получить из их линейной структуры посредством изучения
32
отдельных участков и получения свойств отдельных генов, имеются примеры, указывающие на то, что это не всегда так. Весьма близкие последовательности могут выполнять совершенно разные функции (см., например, [79] – [83]). В то же время принципиально различные последовательности могут выполнять одинаковые функции (см., например, [84] – [88]). Одной из основных причин этого является то, что линейная структура биологических последовательностей не отражает их трехмерных свойств, которые несут достаточно важную смысловую нагрузку: на уровне трехмерных структур могут наблюдаться мутации (см., например, [89] – [91]); трехмерные структуры имеют непосредственное отношение к склонности и сопротивляемости болезням, в частности, это справедливо по отношению к болезни Альцгеймера [92]. Таким образом, исследования по использованию молекул DNA topoisomerase представляют интерес не только с точки зрения конструирования нанорешеток с заданными
свойствами,
но
и
для
конструирования
различных
медицинских
нанороботов. Кроме того, для нанотехнологий молекулы DNA topoisomerase представляют интерес как инструмент, позволяющий разрывать связи между нуклеотидами.
В
частности,
это
можно
использовать
при
проектировании
наноустройств на основе принципа свободной энергии. Серия работ [93] – [104] направлена на создание хорошо масштабируемых нанорешеток с периодически повторяющимися свойствами. Для отдельных типов масштабируемых решеток с периодически повторяющимися свойствами [105] предложена технология, позволяющая произвольным образом модифицировать их базовую структуру [106]. В исследованиях [39], [107], [108] акцент сделан на создании нанорешеток со сложной нерегулярной структурой. В [109] проводились исследования по созданию нанорешеток, сохраняющих не только взаимное расположение нуклеотидов, но и заданную трехмерную форму, а также, по разработке технологий, позволяющих регистрировать трехмерную форму нанорешеток. Другим важным строительным материалом для создания наномеханических устройств являются искусственно синтезированные молекулы, отдельные части которых обладают физическими свойствами различных молекул, что позволяет получить молекулу, способную проявлять свойства нескольких молекул одновременно (см., в частности, [110] – [116]). В частности, в [52] предложено устройство,
33
конструктивными элементами которого являются и нанорешетки, и молекулы, проявляющие одновременно свойства ДНК и РНК. Еще одно направление в области создания материалов для наномеханических устройств связано с использованием модифицированных нуклеотидов и аминокислот. У этого пути есть очевидное преимущество, заключающееся в расширении спектра доступных материалов и получении материалов с новыми свойствами, и не менее очевидный недостаток – мы не знаем новых свойств новых материалов. До некоторой степени с получением модифицированных или новых нуклеотидов и аминокислот помогает сама Природа. Хорошо устоявшуюся формулу, согласно которой в ДНК используются четыре вида нуклеотидов, в РНК используются четыре вида нуклеотидов, в белках используется 20 видов аминокислот, нельзя считать абсолютно верной, поскольку есть и другие виды нуклеотидов и аминокислот. Как и в большинстве «хороших» правил, в универсальном генетическом коде есть исключения. При этом под исключениями мы понимаем кодирование, являющееся стандартным для того или иного вида организмов, но отличающееся от универсального. Следует отметить, что кроме исключений могут наблюдаться также аномалии: изменения в коде, связанные с мутациями и механизмами их подавления. На сегодняшний день различных исключений в генетическом коде известно достаточно много. Наиболее типичные из них связаны с изменениями значений кодонов: кодоны могут кодировать другую аминокислоту; кодоны могут кодировать не только свою аминокислоту, но и начало считывания белка и т.д. Кроме исключений, связанных с изменением значений, есть и более серьезные. Например, кодон ACT при определенном контексте может быть не Stop-кодоном, а кодом аминокислоты селеноцистеин, которой в стандартном списке из двадцати аминокислот нет (см., например,
[117], [118]). Большое количество
исключений и мутаций наблюдается и для нуклеотидов. В частности, интересным объектом в этом отношении является транспортная РНК. Транспортная РНК состоят примерно из 70-100 нуклеотидов. Однако при определенных условиях транспортная РНК может выступать в качестве фрагмента в последовательности, состоящей из многих сотен нуклеотидов. Для считывания универсальной кодовой таблицы достаточно 31 разновидности транспортной РНК. Тем не менее даже у бактерий 45 различных транспортных РНК. Для их кодирования используется 78 генов. У дрожжей
34
этих генов – около 400, у дрозофилы – около 750, у лягушки – около 8 000. Таким образом, Природа с большим запасом определяет не только количество различных видов транспортных РНК, но и количество способов их кодирования. Точное объяснение этой «щедрости» биологам еще предстоит найти. Однако это безусловно указывает на особую важность значения транспортной РНК для функционирования живых организмов, а также на высокую потребность в компенсации различных мутаций, наблюдающихся у транспортных РНК. Транспортная РНК считается наиболее изменчивой молекулой (см. [119], [120]). Причем изменениям подвержена не только последовательность нуклеотидов, но и сами нуклеотиды. Интересно отметить, что это свойство наблюдается практически для всех видов организмов вне зависимости от сложности их генома. Изменения в нуклеотидах для транспортной РНК настолько типичное явление, что для
транспортной РНК имеет смысл рассматривать
расширенный алфавит. Кроме четырех стандартных нуклеотидов A, U, C и G, в транспортной РНК используются еще четыре: dihydrouridine (D), pseudouridine (P), ribosylthymine (T), inosine (I). Также в транспортных РНК встречается группа нуклеотидов
methylation
с
общим
обозначением
M.
Встречаются
и
другие
модифицированные нуклеотиды. Структура транспортной РНК достаточно хорошо изучена. В работе [121] построена модель транспортной РНК, считающаяся на сегодняшний день общепризнанной. Эта модель состоит из 76 нуклеотидов. Определенные позиции в транспортной РНК вне зависимости от ее разновидности всегда должны быть заняты нуклеотидами фиксированного вида (в противном случае молекула перестанет правильно функционировать). Имеется всего 27 таких позиций, некоторые из которых обязательно должны быть заняты измененными нуклеотидами. Таким образом, транспортная РНК не только существенно расширяет список доступных для использования нуклеотидов, но и указывает на то, что использование модифицированных
нуклеотидов
не
обязательно
препятствует
использованию
устройств в живых системах. Кроме того, в транспортной РНК можно наблюдать еще одно интересное свойство, связанное с принципом минимизации свободной энергии: некоторые измененные нуклеотиды обладают отрицательной свободной энергией, которая не только препятствует образованию слабой связи самим нуклеотидом, но и мешает соседям. Еще одним источником получения модифицированных нуклеотидов
35
является
использование
стандартных
нуклеотидов
после
обработки
особыми
ферментами. В частности, такие нуклеотиды могут потерять одну или несколько степеней свободы, что позволит им демонстрировать принципиально новые свойства (см., например, [54], пункт 1.2). Наконец, при необходимости можно использовать искусственно созданные новые типы нуклеотидов (см., в частности, [54], пункт 1.3). Отметим, что конструкция вычислительного устройства в работе [51] использует шесть типов нуклеотидов. Хотя теоретические возможности нанобиологической робототехники говорят в пользу того, что в перспективе она способна заменить собой большинство из традиционных технологий, совершенно ясно, что переход на эту технологию может происходить только постепенно и вопрос об интеграции нанобиологических устройств с традиционными еще долго будет оставаться актуальным. Серьезным препятствием на пути
построения
интерфейсов
между
нанобиологическими
устройствами
и
электронными является довольно низкая электропроводность молекул ДНК. Поэтому существенный интерес представляет разработка новых материалов, интегрирующих в себе генетический материал и проводящие материалы. Следует отметить, что исследования в этой области представляют интерес не только с точки зрения создания модифицированных молекул ДНК с высокими проводящими свойствами, но и для разработки новых технологий поатомной сборки металлических соединений и т.д. На сегодняшний день ведутся активные исследования в области взаимодействия генетических материалов с другими функциональными молекулами (см., например, [122] – [134]), в том числе исследуются вопросы взаимодействия нанорешеток с другими материалами (металлами, полупроводниками и др.) (см., например, [135] – [162]). Ведутся исследования в области создания интегрированных конструкций из молекул ДНК и проводящих материалов, например, карбоновых нанотуб (см. [163]). Наиболее интересной представляется технология металлизации молекул ДНК, поскольку она позволяет повысить проводимость самой молекулы ДНК, а не использует молекулы ДНК как связующий материал для проводников. Существует несколько подходов к металлизации ДНК. В частности, нанесение металла на поверхность [164], создание искусственных нуклеотидов, содержащих атомы металла (например, палладия или меди [165], [166]), размещение ионов цинка между
36
нуклеотидами [167]. В первом эксперименте по металлизации [168] была получена функциональная связь ДНК с серебром для установления проводимости между золотыми электродами. Позднее эта технология была существенно улучшена и распространена на ряд других металлов и полупроводников (см., например, [169] – [174]). Литература 1.
Adleman L.M. Molecular computation of solutions to combinatorial problems // Science. 1994. V.266, 1021-1024.
2.
Benenson Y., Paz-Elizur T., Adar R., Keinan E., Livneh Z., Shapiro E. Programmable and autonomous computing machine made of biomolecules // Nature. 2001. V.414. P.430–434.
3.
Benenson Y., Gil B., Ben-Dor U., Adar R., Shapiro E. An autonomous molecular computer for logical control of gene expression // Nature. 2004. V.429. P.423-442.
4.
Benenson Y., Adar R., Paz-Elizur T., Keinan E., Livneh Z., Shapiro E. DNA molecule provides a computing machine with both data and fuel // Proc. Natl Acad. Sci. USA. 2003. V.100. P.2191–2196.
5.
http://bdcc.kmip.net/htmls/dnacomputer/index.php.
6.
Faulhammer D., Cukras A.R., Lipton R.J., Landweber L.F. Molecular computation: RNA solution to chess problems // Proc. Natl Acad. Sci. USA. 2000. V.97. P.1385-1389.
7.
Landweber L.F., Lipton R.J., Rabin M.O. DNA computations: A potential ―Killer App‖? // H.Rubin and D.H.Wood, editors. DNA Based Computers III: DIMACS Workshop, June 23-27, 1997. University of Pennsylvania, Providence, Rhode Island, 1997. P.161-172.
8.
Lipton R.J. DNA solution of hard computational problem // Science. 1995. V.268. P.542-545.
9.
Faulhammer D., Cukras A.R., Lipton R.J., Landweber L.F. When the knight falls: On constructing an RNA computer // E.Winfree, D.K.Gifford, editors. Proc. 5th DIMACS Workshop on DNA Based Computers held at the Massachusetts Institute of
37
Technology, Cambridge, MA, 1999. DIMACS: Series in Discrete Math. and Theoretical Computer Sci., Providence, Rhode Island, 2000. P.1-8. 10.
Liu Q., Wang L., Frutos A.G., Condon A.E., Corn R.M., Smith L.M. DNA computing on surfaces // Nature. 2000. V.403. P.175-179.
11.
Mao C., LaBean T.H., Reif J.H., Seeman N.C. Logical Computation Using Algorithmic Self-Assembly of DNA Triple Crossover Molecules // Nature. 2000. V.407. P.493-496.
12.
Ouyang Q., Kaplan P.D., Liu S., Libchaber A. DNA solution of the maximal clique problem // Science. 1997. V.278. P.446-449.
13.
Reif J.H. Parallel Biomolecular Computation: Models and Simulations // Proceedings: 7th Annual ACM Symposium on Parallel Algorithms and Architectures (SPAA'95) Santa Barbara, CA, July 1995. P.213-223.
14.
Reif J.H. Local Parallel Biomolecular Computation // Proc. DNA-Based Computers, III: University of Pennsylvania, June 23-26, 1997. DIMACS Series in Discrete Mathematics and Theoretical Computer Science, H. Rubin and D. H. Wood, editors. American Mathematical Society, Providence, RI, 1999. P.217-254.
15.
Reif J.H. Paradigms for Biomolecular Computation // First International Conference on Unconventional Models of Computation, Auckland, New Zealand, January 1998. Unconventional Models of Computation, edited by C.S. Calude, J. Casti, and M.J. Dinneen, Springer-Verlag, New York, January 1998. P.72-93.
16.
Gehani A., Reif J.H. Micro Flow Bio-Molecular Computation // Journal of Biological and Informational Processing Sciences. 1999. V.52. N1-3. P.197-216.
17.
Rothemund P.W.K. A DNA and restriction enzyme implementation of Turing machines // R.J.Lipton and E.B.Baum, editors. DNA Based Computers: Proceedings of the DIMACS Workshop, April 4, 1995, Princeton University, Providence, Rhode Island, 1996. P.75-119.
18.
Ruben A.J., Landweber L.F. The past, present and future of molecular computing // Nature Rev. Mol. Cell. Biol. 2000. V.1. P.69-72.
19.
Smith W.D. DNA computers in vitro and in vivo // R.J.Lipton and E.B.Baum, editors. DNA Based Computers: Proceedings of the DIMACS Workshop, April 4, 1995, Princeton University, Providence, Rhode Island, 1996. P.121-185.
38
20.
Winfree E. On the computational power of DNA annealing and ligation // R.J.Lipton and E.B.Baum, editors. DNA Based Computers: Proceedings of the DIMACS Workshop, April 4, 1995, Princeton University, Providence, Rhode Island, 1996. P.199-221.
21.
Amos M. DNA computation. PhD Thesis, Univ. of Warwick, Dept. of Computer Sci., 1997.
22.
Amos M. Theoretical and experimental DNA computation // Bull. EATCS. 1999. V.67. P.125-138.
23.
Amos M. Theoretical and experimental DNA computation. Berlin, Springer, 2004.
24.
Amos M. et al. Practical implementation of DNA computations // C.S.Calude, J.Casti, M.J.Dinneen, editors. Unconventional Models of Computation. Berlin, Springer, 1998. P.1-18.
25.
Amos M., Paun G., Rozenberg G., Salomaa A. Topics in the theory of DNA computing // Theoretical Computer Sci. 2002. V.287. P.3-38.
26.
Paun G. Membrane computing: Main ideas, basic results, applications // Molecular Computational Models: Unconventional Approaches (M. Gheorghe, ed.), Idea Group Publ., London, 2004. P.1-31.
27.
Ibarra O.H., Paun G. Membrane computing: A general view // Annals of European Academy of Sciences, 2008.
28.
Braich R.S. et al. Solution of a satisfiability problem on a gel-based DNA computer // A.Condon, G.Rosenberg, editors. DNA computing, 6th Intern. Workshop on DNA Based Computers, Leiden, 2000, LNCS 2054. Berlin, Springer, 2001. P.2742.
29.
Guarnieri F., Fliss M., Bancroft C. Making DNA add // Science. 1996. V.273. P.220-223.
30.
Khodor J., Gifford D.K. Design and implementation of computational systems based on programmed mutagenesis // BioSystems. 1999. V.52. P.93-97.
31.
Khodor J., Gifford D.K. Programmed mutagenesis is a universal model of computation // N.Jonoska, N.C.Seeman, editors. 7th Intern. Workshop on DNA Based Computers, Tampa, FL, 2001, LNCS 2340. Berlin, Springer, 2002, P.300-37.
32.
Leete T.H., Klein J.P., Rubin H. Bit operations using a DNA template // H.Rubin
39
and D.H.Wood, editors. DNA Based Computers III: DIMACS Workshop, June 23-27, 1997. University of Pennsylvania, Providence, Rhode Island, 1997. P.159-171. 33.
Morimoto N., Arita M., Suyama A. Solid phase DNA solution to the Hamiltonian path problem // H.Rubin and D.H.Wood, editors. DNA Based Computers III: DIMACS Workshop, June 23-27, 1997. University of Pennsylvania, Providence, Rhode Island, 1997. P.193-206.
34.
Wood D.H., et al. In vitro selection for a OneMax DNA evolutionary computation // E.Winfree, D.K.Gifford, editors. Proc. 5th DIMACS Workshop on DNA Based Computers held at the Massachusetts Institute of Technology, Cambridge, MA, 1999. DIMACS: Series in Discrete Math. and Theoretical Computer Sci., Providence, Rhode Island, 2000. P.23-38.
35.
Wood D.H., et al. DNA starts to learn poker // N.Jonoska, N.C.Seeman, editors. 7th Intern. Workshop on DNA Based Computers, Tampa, FL, 2001, LNCS 2340. Berlin, Springer, 2002, P.92-103.
36.
Yoshida H., Suyama A. Solution to 3-SAT by breadth first search // H.Rubin and D.H.Wood, editors. DNA Based Computers III: DIMACS Workshop, June 23-27, 1997. University of Pennsylvania, Providence, Rhode Island, 1997. P.9-22.
37.
Seeman N.C. Nucleic Acid Junctions and Lattices // Journal of Theoretical Biology. 1982. V.99. P.237-247.
38.
LaBen T.H., Yan H., Kopatsch J., Liu F., Winfree E., Reif J.H, Seeman N.C. The Construction of DNA Triple Crossover Molecules // Journal of the American Chemical Society. 2000. V.122. P.1848-1860.
39.
Yan H., LaBean T.H., Feng L., Reif J.H. Directed Nucleation Assembly of Barcode Patterned DNA Lattices // Proceedings of the National Academy of Science. 2003. V.100. N14. P.8103-8108.
40.
Yan H., Park S.H., Finkelstein G., Reif J.H., LaBean T.H. DNA-Templated SelfAssembly of Protein Arrays and Highly Conductive Nanowires // Science. 2003. V.301. P.1882-1884.
41.
Li H., Park S.H., Reif J.H., LaBean T. H., Yan H. J DNA-Templated SelfAssembly of Protein and Nanoparticle Linear Arrays // Journal of American Chemistry Society. 2004. V.126. N2. P.418-419.
40
42.
Park S.H., Yan H., Reif J.H., LaBean T.H., Finkelstein G. Electronic nanostructures templated on self-assembled DNA scaffolds // Nanotechnology. 2004. V.15. P.525–527.
43.
Wilhelm P., Rothemund P.W. A DNA and restriction enzyme implementation of Turing machines // DIMACS Series in Discrete Mathematics and Theoretical Computer Science. 1995. P.75-119.
44.
Stojanovic M.N., Stefanovic D. A deoxyribozyme-based Molecular Automaton // Nature Biotechnology. 2003. V.21. N9. P.1069.
45.
Stojanovic M.N., Stefanovic D. Deoxyribozyme-based Half-Adder // J. Am. Chem. Soc. 2003. V.125. N22. P.6673.
46.
Stojanovic M. N., Mitchel T.H.E., Stefanovic D. Deoxyribozyme-based Logic Gates // J. Am. Chem. Soc. 2002. V.124. N14. P.3555-3561.
47.
Stojanovic M.N., de Prada P., Landry D.W. Homogeneous assays based on deoxyribozyme catalysis // Nucleic Acids Res. 2000. V.28. N15. P.2915.
48.
Yin P., Turberfield A.J., Reif J.H. Design of an Autonomous DNA Nanomechanical Device Capable of Universal Computation and Universal Translational Motion // Tenth International Meeting on DNA Based Computers. LNCS 3384, Springer-Verlag, New York, 2005. P.426-444.
49.
Sakamoto K. et al. State transitions by molecules // Biosystems. 1999. V.52. P.81– 91.
50.
Sakamoto K. et al. Molecular computation by DNA hairpin formation // Science. 2000. V.288. P.1223–1226.
51.
Yin P., Turberfield A., Sahu S., Reif J. Design of an autonomous DNA nanomechanical device capable of universal computation and universal translational motion // Tenth International Meeting on DNA Computing. LNCS. 2005. V.3384. P.426–444.
52.
Reif J.H., Sahu S. Autonomous Programmable DNA Nanorobotic Devices Using DNAzymes // 13th International Meeting on DNA Computing (DNA 13), Memphis, Tennessee, June 4-8, 2007. DNA Computing: DNA13 (edited by Max Garzon and Hao Yan), Springer-Verlag LNCS 4848. Springer, Berlin – Heidelberg, 2008. P.66-78.
41
53.
Ehrenfeucht A., Harju T., Petre I., Prescott D.M., Rozenberg G., Landweber L., Kari L. Computation in Living Cells: Gene Assembly in Ciliates . Berlin, Springer, 2004.
54.
Паун Г., Розенберг Г., Саломаа А. ДНК-компьютер. Новая парадигма вычислений. М.: Мир, 2004.
55.
Adar R., Benenson Y., Linshiz G., Rosner A., Tishby N., Shapiro E. Stochastic computing with biomolecular automata // Proc. Natl Acad. Sci. USA. 2004. V.101. P.9960-9965.
56.
Benenson Y., Shapiro, E. Molecular Computing Machines // Dekker. Encyclopedia of Nanoscience and Nanotechnology, Marcel Dekker, 2004. P.2043 – 2055.
57.
Wang Y., Muller J.E., Kemper B., Seeman N.C. The assembly and characterization of 5-arm and 6-arm DNA branched junctions // Biochemistry. 1991. V.30. P.5667-5674.
58.
Chen J., Seeman N.C. Synthesis from DNA of a molecule with the connectivity of a cube // Nature. 1991. V.350. P.631-633.
59.
Zhang Y., Seeman N.C. The construction of a DNA truncated octahedron // J. Am. Chem. Soc. 1994. V.116. P.1661-1669.
60.
Qiu H., Dewan J.C., Seeman N.C. A DNA Decamer with a Sticky End: The crystal structure of d-CGACGATCGT // J. Mol. Biol. 1997. V.267. P.881-898.
61.
Caruthers M.H. Gene synthesis machines // Science. 1985. V.230. P.281-285.
62.
Lashkari D.A., Hunicke-Smith S.P., Norgren R.M., Davis R.W., Brennan T. An automated multiplex oligonucleotide synthesizer: Development of high-throughput, low-cost DNA synthesis // Proc. Nat. Acad. Sci. (USA). 1995. V.92. P.7912-7915.
63.
Hagerman P.J. Flexibility of DNA // Ann. Rev. Biophys. & Biophys. Chem. 1988. V.17. P.265-286.
64.
Seeman N.C., Rosenberg J.M., Rich A. Sequence specific recognition of double helical nucleic acids by proteins // Proc. Nat. Acad. Sci. (USA). 1976. V.73. P.804808.
65.
Ma R.-I., Kallenbach N.R., Sheardy R.D., Petrillo M.L., Seeman N.C. Three arm nucleic acid junctions are flexible // Nucl. Acids Res. 1986. V.14. P.9745-9753.
42
66.
Petrillo M.L., Newton C.J., Cunningham R.P., Ma R.-I., Kallenbach N.R., Seeman, N.C. Ligation and flexibility of four-arm DNA junctions // Biopolymers. 1988. V.27. P.1337-1352.
67.
Kappraff J. Connections. McGraw-Hill, New York, 1990.
68.
Chen J.H., Kallenbach N.R., Seeman N.C. A specific quadrilateral synthesized from DNA branched junctions // J. Am. Chem. Soc. 1989. V.111. P.6402-6407.
69.
Zhang Y., Seeman N.C. A solid-support methodology for the construction of geometrical objects from DNA // J. Am. Chem. Soc. 1992. V.114. P.2656-2663.
70.
Chen J., Seeman N.C. The electrophoretic properties of a DNA cube and its substructure catenanes // Electrophoresis. 1991. V.12. P.607-611.
71.
Seeman N.C. Design of single-stranded nucleic acid knots // Mol. Engineering. 1992. V.2. P.297-307.
72.
Rich A., Nordheim A., Wang A.H.-J. The chemistry and biology of left-handed ZDNA // Ann. Rev. Biochem. 1984. V.53. P.791-846.
73.
Du S.M., Stollar B.D., Seeman N.C. A synthetic DNA molecule in three knotted topologies // J.Am.Chem.Soc. 1995. V.117. P.1194-1200.
74.
Du S.M., Wang H., Tse-Dinh Y.-C., Seeman N.C. Topological transformations of synthetic DNA knots // Biochemistry. 1995. V.34. P.673-682.
75.
Wang H., Di Gate R.J., Seeman N.C. An RNA topoisomerase // Proc. Nat. Acad. Sci. (USA). 1996. V.93. P.9477-9482.
76.
Mao C., Sun W., Seeman N.C. Assembly of Borromean rings from DNA // Nature. 1997. V.386. P.137-138.
77.
Liang C., Mislow K. On Borromean links // J. Math. Chem. 1994. V.16. P.27-35.
78.
Du S.M., Seeman N.C. The construction of a trefoil knot from a DNA branched junction motif // Biopolymers. 1994. V.34. P.31-37.
79.
Bork P., Eisenberg D. Deriving biological knowledge from genomic sequences // Curr. Opin. Struct. Biol. 1998. V.8. P.331-332.
80.
Bork P., Ouzounis C., Sander C. From genome sequences to protein function // Curr. Opin. Struct. Biol. 1994. V.4. P.393-403.
43
81.
Cooper D.L., Isola N.R., Stevenson K., Baptist E.W. Members of the ALDH gene family are lens and corneal Crystallins // Advan. Exp. Med. Biol. 1993. V.328. P.169179.
82.
Koonin E.V., Tatusov R.I. Computer analysis of bacterial haloacid dehalogenases defines a large superfamily of hydrolases with diverse specificity. Application of an iterative approach to database search // J. Mol. Biol. 1994. V.244. P.125-132.
83.
Seery L.T., Nestor P.V., FitzGerald G.A. Molecular evolution of the aldo-keto reductase gene superfamily // J. Mol. Evol. 1998. V.46. P.139-146.
84.
Bork P., Sander C., Valencia A. Convergent evolution of similar enzymatic function on different protein folds: the hexokinase, ribokinase, and galactokinase families of sugar kinases // Protein Sci. 1993. V.2. P.31-40.
85.
Chen L., DeVries A.L., ChengC.H. Conversent evolution of antifreeze glycoproteins in Antarctic notothenioid fish and Arctic cod // Proc. Natl. Acad. Sci. USA. 1997. V.94. P.3817-3822.
86.
Doolittle R.F. Convergent evolution: the need to be explicit // Trends Biochem. Sci. 1994. V.19. P.15-18.
87.
Ibba M., Bono J.L., Rosa P.A., Soll D. Archaeal-type Lysyl-tRNA synthetase in the Lyme disease spirochete Borrelia burgdorferi // Proc. Natl. Acad. Sci. USA. 1997. V.94. P.14383-14388.
88.
Ibba M., Morgan S., Curnow A.W., Pridmore D.R., Vothknecht U.C., Gardner W., Lin W., Woese C.R., Soll D. A euryarchaeal lysyl-tRNA synthetase: resemblance to class I synthetases // Science. 1997. V.278. P.1119-1122.
89.
George S.E., Simokat K., Hardin I., Chisholm A.D. The VAB-1 Eph receptor tyrosine kinase functions in neural and epithelian morphogenesis in C.elegans // Cell. 1998. V.92. P.633-643.
90.
Kimura K.D., Tissenbaum H.A., Liu Y., Ruvkun G. daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans // Science. 1997. V.277. P.942-946.
91.
Nicholls A., Sharp K., Honig B. Protein folding and association: insights from the interfacial and thermodynamic properties of hydrocarbons // Proteins. 1991. V.11. P.281-296.
44
92.
Sauder J.M., Dunbrack R.L. Jr. Genomic fold assignment and rational modeling of proteins of biological interest.
93.
Seeman N.C. Nucleic acid junctions and lattices // J. Theor. Biol. 1982. V.99. P.237-247.
94.
Robinson B.H., Seeman N.C. Design of a biochip // Prot. Eng. 1987. V.1. P.295300.
95.
Liu B., Leontis N.B., Seeman N.C. Bulged 3-arm DNA branched junctions as components for nanoconstruction // Nanobiol. 1995. V.3. P.177-188.
96.
Qi J., Li X., Yang X., Seeman N.C. The ligation of triangles built from bulged three-arm DNA branched junctions // J. Am. Chem. Soc. 1996. V.118. P.6121-6130.
97.
Fu T.-J., Seeman N.C. DNA double crossover structures // Biochem. 1993. V.32. P.3211-3220.
98.
Li X., Yang X., Qi J., Seeman N.C. Antiparallel DNA double crossover molecules as components for nanoconstruction // J. Am. Chem. Soc. 1996. V.118. P.6131-6140.
99.
Schwacha A., Kleckner N. Identification of double Holliday junctions as intermediates in meiotic recombination // Cell. 1995. V.83. P.783-791.
100.
Fu T.-J., Kemper B., Seeman N.C. Endonuclease VII cleavage of DNA double
crossover molecules // Biochem. 1994. V.33. P.3896-3905. 101.
Fu T.-J., Tse-Dinh Y.-C., Seeman N.C. Holliday junction crossover topology // J.
Mol. Biol. 1994. V.236. P.91-105. 102.
Zhang S., Seeman N.C. Symmetric Holliday junction crossover isomers // J. Mol.
Biol. 1994. V.238. P.658-668. 103.
Li X., Wang H., Seeman N.C. Direct evidence for Holliday junction crossover
isomerization // Biochem. 1997. V.36. P.4240-4247. 104.
Zhang S., Fu T.-J., Seeman N.C. Construction of symmetric, immobile DNA
branched junctions // Biochem. 1994. V.32. P.8062-8067. 105.
Mao C., LaBean T.H., Reif J.H., Seeman N.C. Logical Computation Using
Algorithmic Self-Assembly of DNA Triple-Crossover Molecules // Nature. 2000. V.407. P.493-495.
45
106.
Park S.H., Pistol C., Ahn S.J., Reif J.H., Lebeck A.R., Dwyer C., LaBean T.H.
Finite-size, fully addressable dna tile lattices formed by hierarchical assembly procedures // Angew. Chem. Int. Ed. 2006. V.45. P.735-739. 107.
Rothemund P. Generation of arbitrary nanoscale shapes and patterns by scaffolded
DNA origami // Nature. 2005. 108.
Rothemund P. Folding DNA to create nanoscale shapes and patterns // Nature.
2006. V.440. P.297-302. 109.
Shih W.M., Quispe J.D., Joyce G.F. A 1.7-kilobase single-stranded DNA that
folds into a nanoscale octahedron // Nature. 2004. V.427. P.618-621. 110.
Chen Y., Mao C. Putting a brake on an autonomous DNA nanomotor // J. Am.
Chem. Soc. 2004. V.126. P.8626–8627. 111.
Chen Y., Wang M., Mao C.. An autonomous DNA nanomotor powered by a DNA
enzyme // Angew. Chem. Int. Ed. 2004. V.43. P.3554–3557. 112.
C.M.J., Andrew K., Lun-Quan S. Optimisation of the 10-23 dnazyme-substrate
pairing interactions enhanced rna cleavage activity at purine-cytosine target sites // Nucleic acids research. 2003. V.31. P.2883–2889. 113.
L. J., Zheng W., Kwon A., Lu Y. In vitro selection and charcterization of a highly
efficient zn(ii) dependent, rna-cleaving deoxyribozyme // Nucleic acids research. 2000. V.28. P.481–488. 114.
S. S.W., Joyce G. Mechanism and utility of an rna-cleaving dna enzyme //
Biochemistry. 1998. V.37. P.13330–13342. 115.
Tian Y., He Y., Chen Y., Yin P., Mao C. Molecular devices - a DNAzyme that
walks processively and autonomously along a one-dimensional track // Angew. Chem. Intl. Ed. 2005. V.44. P.4355–4358. 116.
Mayer G., Ackermann D., Kuhn N., Famulok M. Construction of DNA
Architectures with RNA Hairpins // Angew. Chem. Int. Ed. 2008. V.47. P.971–973. 117.
Инге-Вечтомов С.Г. Трансляция как способ существования живых систем,
или в чем смысл «бессмысленных» кодонов // Соросовский образовательный журнал. 1996. N12. C.2-10. 118.
Овчинников Л.П. Что и как закодировано в мРНК // Соросовский
образовательный журнал. 1998. N4. C.10-18.
46
119.
Sprinzl M., Horn C., Brown M., Ioudovitch A., Steinberg S. Compilation of tRNA
sequences and sequences of tRNA genes // Nucleic Acids Research. 1998. V.26. P.148-153. 120.
Woese C.R., Kandler O., Wheelis M.L. Towards a natural system of organisms:
proposal for the domains archaea, bacteria and eucarya // Proc. Natl. Acad. Sci. USA. 1990. V.87. P.4576-4579. 121.
Holley R.W. Structure of an alanine transfer ribonucleic acid // JAMA. 1965.
V.194. P.868-871. 122.
Becerril H.A., Stoltenberg R.M., Monson C.F., Woolley A.T. Ionic Surface
Masking for Low Background in Single- and Double-stranded DNA-Templated Silver and Copper Nanorods // J. Mater. Chem. 2004. V.14. P.611-616. 123.
Ford W.E., Harnack O., Yasuda A., Wessels J.M. Platinated DNA as Precursors to
Templated Chains of Metal Nanoparticles // Adv. Mater. 2001. V.13. P.1793-1797. 124.
Richter J., Mertig M., Pompe W., Monch I., Schackert H.K. Construction of highly
conductive nanowires on a DNA template // Appl. Phys. Lett. 2001. V.78. P.536-538. 125.
Gu Q., Cheng C., Haynie D.T. Cobalt Metallization of DNA: Toward Magnetic
Nanowires // Nanotechnology. 2005. V.16. P.1358-1363. 126.
Monson C.F., Woolley A.T. DNA-Templated Construction of Copper Nanowires
// Nano Lett. 2003. V.3. P.359-363. 127.
Stoltenberg R.M., Woolley A.T. DNA-Templated Nanowire Fabrication //
Biomed. Microdevices. 2004. V.6. P.105-111. 128.
Becerril H.A., Stoltenberg R.M., Wheeler D.R., Davis R.C., Harb J.N., Woolley
A.T. DNA-Templated Three-Branched Nanostructures for Nanoelectronic Devices // J. Am. Chem. Soc. 2005. V.127. P.2828-2829. 129.
Coffer J.L., Bigham S.R., Li X., Pinizzotto R.F., Rho Y.G., Pirtle R.M., Pirtle I.L.
Dictation of the Shape of Mesoscale Semiconductor Nanoparticle Assemblies by Plasmid DNA // Appl. Phys. Lett. 1996. V.69. P.3851-3853. 130.
Liang H., Angelini T.E., Braun P.V., Wong G.C.L. Roles of Anionic and Cationic
Template Components in Biomineralization of CdS Nanorods using Self-Assembled DNA-Membrane Complexes // J. Am. Chem. Soc. 2004. V.126. P.14157-14165.
47
131.
Nyamjav D., Ivanisevic A. Templates for DNA-Templated Fe3O4 Nanoparticles //
Biomaterials. 2005. V.26. P.2749-2757. 132.
Csaki A., Maubach G., Born D., Reichert J., Fritzsche W. DNA-Based Molecular
Nanotechnology // Single Mol. 2002. V.3. P.275-280. 133.
Niemeyer C.M. The Developments of Semisynthetic DNA-Protein Conjugates //
Trends Biotechnol. 2002. V.20. P.395-401. 134.
Li H., Park S.H., Reif J.H., LaBean T.H., Yan H. DNA-templated Self-Assembly
of Protein and Nanoparticle Linear Arrays // J. Am. Chem. Soc. 2004. V.126. P.418419. 135.
Yan H., Park S.H., Finkelstein G., Reif J.H., LaBean T.H. DNA-Templated Self-
Assembly of Protein Arrays and Highly Conductive Nanowires // Science. 2003. V.301. P.1882-1884. 136.
Le J.D., Pinto Y., Seeman N.C., Musier-Forsyth K., Taton T.A., Kiehl R.A. DNA-
Templated Self-Assembly of Metallic Nanocomponent Arrays on a Surface // Nano Lett. 2004. V.4. P.2343-2347. 137.
Parak W.J., Gerion D., Zanchet D., Woerz A.S., Pellegrino T., Micheel C.,
Williams S.C., Seitz M., Bruehl R.E., Bryant Z., Bustamante C., Bertozzi C.R., Alivisatos A.P. Conjugation of DNA to Silanized Colloidal Semiconductor Nanocrystalline Quantum Dots // Chem. Mater. 2002. V.14. P.2113-2119. 138.
Zanchet D., Micheel C.M., Parak W.J., Gerion D., Alivisatos A.P. Electrophoretic
Isolation of Discrete Au Nanocrystal/DNA Conjugates // Nano Lett. 2001. V.1. P.3235. 139.
Zhang J., Liu Y., Ke Y., Yan H. Periodic Square-Like Gold Nanoparticle Arrays
Templated by Self-Assembled 2D DNA Nanogrids on a Surface // Nano Lett. 2006. V.6. P.248-251. 140.
Zheng J., Constantinou P.E., Micheel C., Alivisatos A.P., Kiehl R.A., Seeman
N.C. Two-Dimensional Nanoparticle Arrays Show the Organizational Power of Robust DNA Motifs // Nano Lett. 2006. V.6. P.1502-1504. 141.
Harnack O., Ford W.E., Yasuda A., Wessels J.M. Tris(hydroxymethyl)phosphine-
Capped Gold Particles Templated by DNA as Nanowire Precursors // Nano Lett. 2002. V.2. P.919-923.
48
142.
Nyamjav D., Ivanisevic A. Templates for DNA-Templated Fe3O4 Nanoparticles //
Biomaterials. 2005. V.26. P.2749-2757. 143.
Tanaka S., Fritzsche W., Sako Y., Yanagida T. Synthesis of Long-Template DNA
Using Enzymatic Reaction for Regular Alignment of Au-Nanoparticles // Chem. Lett. 2006. V.35. P.1290-1291. 144.
Csaki A., Garwe F., Steinbrueck A., Maubach G., Festag G., Weise A., Riemann
I., Koenig K., Fritzsche W. A Parallel Approach for Subwavelength Molecular Surgery Using Gene-Specific Positioned Metal Nanoparticles as Laser Light Antennas // Nano Lett. 2007. V.7. P.247-253. 145.
Richter J., Mertig M., Pompe W., Monch I., Schackert H.K. Construction of
Highly Conductive Nanowires on a DNA Template // Appl. Phys. Lett. 2001. V.78. P.536-538. 146.
Monson C.F., Woolley A.T. DNA-Templated Construction of Copper Nanowires
// Nano Lett. 2003. V.3. P.359-363. 147.
Becerril H.A., Stoltenberg R.M., Monson C.F., Woolley A.T. Ionic Surface
Masking for Low Background in Single- and Double-Stranded DNA-Templated Silver and Copper Nanorods // J. Mater. Chem. 2004. V.14. P.611-616. 148.
Park S.H., Barish R., Li H., Reif J.H., Finkelstein G., Yan H., LaBean T.H. Three-
Helix Bundle DNA Tiles Self-Assemble into 2D Lattice or 1D Templates for Silver Nanowires // Nano Lett. 2005. V.5. P.693-696. 149.
Gu Q., Cheng C., Haynie D.T. Cobalt Metallization of DNA: Toward Magnetic
Nanowires // Nanotechnology. 2005. V.16. P.1358-1363. 150.
Coffer J.L., Bigham S.R., Li X., Pinizzotto R.F., Rho Y.G., Pirtle R.M., Pirtle I.L.
Dictation of the Shape of Mesoscale Semiconductor Nanoparticle Assemblies by Plasmid DNA // Appl. Phys. Lett. 1996. V.69. P.3851-3853. 151.
Dittmer W.U., Simmel F.C. Chains of Semiconductor Nanoparticles Templated on
DNA // Appl. Phys. Lett. 2004. V.85. P.633-635. 152.
Xin H., Woolley A.T. DNA-Templated Nanotube Localization // J. Am. Chem.
Soc. 2003. V.125. P.8710-8711. 153.
Xin H., Woolley A.T. High-Yield DNA-Templated Assembly of Surfactant-
Wrapped Carbon Nanotubes // Nanotechnology. 2005. V.16. P.2238-2241.
49
154.
Niemeyer C.M., Adler M., Pignataro B., Lenhert S., Gao S., Chi L., Fuchs H.,
Blohm D. Self-Assembly of DNA-Streptavidin Nanostructures and Their Use as Reagents in Immuno-PCR // Nucleic Acids Res. 1999. V.27. P.4553-4561. 155.
Yan H., Park S.H., Finkelstein G., Reif J.H., LaBean T.H. DNA-Templated Self-
Assembly of Protein Arrays and Highly Conductive Nanowires // Science. 2003. V.301. P.1882-1884. 156.
Becerril H.A., Ludtke P., Willardson B.M., Woolley A.T. DNA-Templated Nickel
Nanostructures and Protein Assemblies // Langmuir. 2006. V.22. P.10140-10144. 157.
He Y., Tian Y., Ribbe A.E., Mao C. Antibody Nanoarrays with a Pitch of ~20
Nanometers // J. Am. Chem. Soc. 2006. V.128. P.12664-12665. 158.
Richter J. Metallization of DNA // Physica E. 2003. V.16. P.157-173.
159.
Seidel R., Ciacchi L.C., Weigel M., Pompe W., Mertig M. Synthesis of Platinum
Cluster Chains on DNA Templates: Conditions for a Template-Controlled Cluster Growth // J. Phys. Chem. B. 2004. V.108. P.10801-10811. 160.
Ongaro A., Griffin F., Beecher P., Nagle L., Iacopino D., Quinn A., Redmond G.,
Fitzmaurice D. DNA-Templated Assembly of Conducting Gold Nanowires between Gold Electrodes on a Silicon Oxide Substrate // Chem. Mater. 2005. V.17. P.19591964. 161.
Lund J., Dong J., Deng Z., Mao C., Parviz B.A. Electrical Conduction in 7 nm
Wires Constructed on λ-DNA // Nanotechnology. 2006. V.17. P.2752-2757. 162.
Deng Z., Mao C. Metallic Nanostructures: Molecular Lithography with DNA
Nanostructures // Angew. Chem. Int. Ed. Engl. 2004. V.43. P.4068-4070. 163.
Keren K., Bergman R.S., Buchstab E., Sivan U., Braun E. DNA-templated carbon
nanotube field-effect transistor // Science. 2003. V.302. P.1380-1382. 164.
Hopkins D.S., Pekker D., Goldbart P.M., Bezryadin A. Quantum interference
device made by DNA templating of superconducting nanowires // Science. 2005. P.1762-1765. 165.
Tanaka K., Shionoya M. Synthesis of a novel nucleoside for alternative DNA base
pairing through metal complexation // Journal of Organic Chemistry. 1999. P.50025003.
50
166.
Weizman H., Tor Y. 2,2'-bipyridine ligandoside: a novel building block for
modifying DNA with intra-duplex metal complexes // Journal of The American Chemical Society. 2001. P.3375-3376. 167.
Aich P., Labiuk S.L., Tari L.W., Delbaere L.J.T., Roesler W.J., Falk K.J., Steer
R.P., Lee J.S. M-DNA: a complex between divalent metal ions and DNA which behaves as a molecular wire // Journal of Molecular Biology. 1999. P.477-485. 168.
Braun E., Eichen Y., Sivan U., Ben-Yoseph G. DNA-templated assembly and
electrode attachment of a conducting silver wire // Nature. 1998. V.391. P.775-777. 169.
Keren K., Krueger M., Gilad R., BenYoseph G., Sivan U., Braun E. Sequence
specific molecular lithography on single DNA molecules // Science. 2002. V.297. P.72-75. 170.
Keren K., Bergman R.S., Braun E. Patterned DNA metallization by sequence
specific localization of a reducing agent // Nano Letters. 2004. V.4. P.323-326. 171.
Richter J., Seidel R., Kirsch R., Mertig M., Pompe W., Plaschke J., Schackert H.K.
Nanoscale palladium metallization of DNA // Advanced Materials. 2000. P.507-510. 172.
Torimoto T., Yamashita M., Kuwabata S., Sakata T., Mori H., Yoneyama H.
Fabrication of cds nanoparticle chains along DNA double strands // Journal of Physical Chemistry B. 1999. P.8799-8803. 173.
Dittmer W.U., Simmel F.C. Chains of semiconductor nanoparticles templated on
DNA // Applied Physics Letters. 2004. V.4. P.3550-3553. 174.
Hazarika P., Ceyhan B., Niemeyer C.M. Reversible Switching of DNA–Gold
Nanoparticle Aggregation // Angew. Chem. Int. Ed. 2004. V.43. P.6469 –6471.
51
4. Модели нанороботов В современных нанотехнологиях большое внимание уделяется разработке различных
наномеханических
устройств,
являющихся
аналогами
простейших
традиционных механических узлов. Это моторы для прямолинейного движения [1], [2], роторные моторы [3] – [8], передаточные приводы [9], переключатели [10] – [11], челноки (идея, впервые предложенная в [12], получила интенсивное развитие [13] – [16], в частности, активно исследуются конструкции челноков на основе химических [17] – [21], электрохимических [22], [23] и фотохимических [24] – [26] технологий), турникеты [27], храповики [28], щипцы [29], [30], ножницы [31], элеваторы [32]. Технология
обнаружения
конкретных
нуклеотидов
и
нуклеотидных
последовательностей является критической как для исследования генетических материалов, так и для мониторинга деятельности наномеханических роботов, в частности, для считывания информации с наномеханических вычислительных устройств. Традиционно для обнаружения конкретных нуклеотидов и нуклеотидных последовательностей используется метод, заключающийся в маркировке нуклеотидов. Однако этот метод, во-первых, является весьма трудоемким и потому непригоден для массового использования, во-вторых, может нарушить среду, в которой функционирует наномеханическое устройство, в-третьих, меняет физические свойства нуклеотидов, что может повлечь отказ наномеханического устройства. Поэтому в последние годы активно изучаются методы обнаружения нуклеотидов, не использующие маркеров. В частности,
предложены
оптические
[33]
–
[37],
электрохимические
[38]
и
пьезоэлектрические [39] сенсоры (см. также [40] – [43]). Интересно отметить, что в работе [44] предложена модель наномеханического сенсора (см. также [45] – [47]). Развитие этой технологии может позволить для мониторинга деятельности одного наномеханического робота использовать другой. Все
наномеханические
небиологические,
гибридные
устройства и
естественным
биологические.
При
образом этом
делятся
на
большинство
небиологических и гибридных устройств привлекает для функционирования внешние источники энергии, а для биологических устройств активно развивается направление по созданию механизмов с автономным питанием. На сегодняшний день существуют
52
гибридные устройства на основе электрохимический [48] – [53], оптической [54] – [59], магнитной [60], [61] и механической технологий [44]. Активно развивается направление, в рамках которого в качестве источника энергии для наномеханических устройств предполагается использовать свет или иные виды электромагнитного облучения (см., например, [62] – [65]). В [5] и [6] предложены роторные моторы на основе энергии света. В работе [66] предложена конструкция наномеханического устройства на оптической энергии, состоящего из одной молекулы, полученой полимеризацией azobenzene. Следует отметить, что физические свойства azobenzene хорошо изучены и такие молекулы уже неоднократно применялись в различных фотозависимых системах (см. [67] – [88]). Устройства, осуществляющие механическое движение на основе электростатического взаимодействия ионов предложены в работах [89] и [90]. Молекулы РНК имеют много различных полезных свойств, благодаря которым они играют важнейшую роль во внутриклеточных процессах. В частности, они могут выступать носителями информации, источниками энергии и т.д. Значительную часть молекул РНК можно рассматривать как механические устройства, выполняющие простейшие операции. Эти устройства являются сенсорами, переключателями, катализаторами и др. Механическая модель функционирования этих естественных устройств была впервые обнаружена при изучении интронов [91] и позднее раскрыта в исследованиях [92] – [102]. В частности, в [102] в 1990 году было опубликовано об обнаружении первого сенсора естественного происхождения. В том же году появились первые публикации экспериментов с искусственно созданными сенсорами (см. [103], [104]) и катализаторами (см. [105]). Использованный при получении этих устройств метод заключается в экспериментальном исследовании последовательностей РНК, которое осуществляется в рамках процесса направленной эволюции (SELEX: systematic evolution of ligands by exponential enrichment [104]), цель которого – обеспечение выполнимости фиксированного свойства и отсечение побочных свойств. Процесс направленной эволюции предоставил исследователям сравнительно простой и эффективный инструмент получения генетических последовательностей с заданными свойствами, что привело к весьма бурному развитию исследований по созданию наномеханических устройств на основе РНК и ДНК (см. [103] – [1007]).
53
Стандартный метод направленной эволюции SELEX предназначен, вообще говоря, только для конструирования механических сенсоров. В рамках этого метода берется генетическая последовательность, распознавание которой по каким-либо соображениям представляет интерес. После этого генерируется популяция случайных последовательностей РНК. Распознаваемая последовательность обездвиживается и на нее направляется сгенерированная популяция. Наблюдение за взаимодействием последовательностей РНК и распознаваемой последовательности позволяет определить то, какие именно участки последовательности отвечают за те или иные свойства, кроме того, это дает возможность из случайного набора последовательностей выбрать последовательность, обладающую заданными свойствами. После этого осуществляется селекция популяции. В качестве критерия приспособленности выступает способность последовательности
РНК
обнаружить
распознаваемую
последовательность,
переместиться к ней и прикрепиться на ней. Используется также направленная эволюция, при которой в качестве распознаваемой последовательности выступает какая-либо нежелательная последовательность и, соответственно, последовательности РНК, распознающие эту последовательность, исключаются из дальнейшего отбора (см., например, [180], [304], [345], [346], [376], [383], [446], [552], [604], [736], [917], [783]). Обычно цикл направленной эволюции повторяется от пяти до пятнадцати раз. В результате успешной эволюции получается последовательность РНК, которую можно рассматривать как механический сенсор. Типичный подход к созданию начальной популяции последовательностей РНК, участвующей в направленной эволюции, заключается в том, что берется некоторая последовательность РНК, некоторые участки этой последовательности оставляются неизменными, а остальные подвергаются интенсивной модификации. Размеры модифицируемых областей последовательностей, участвующих в направленной эволюции, представляют весьма важное значение для конструирования устройств. Наиболее типичными являются области от 40 до 80 нуклеотидов. Широко используются и меньшие по размерам области. Например, в работах [252], [326], [375], [564], [597], [604], [635] рассматривались области от 20 до 23 нуклеотидов. В [486] рассматривалась последовательность вида
54
X[1]X[2]X[3]X[4]X[5], где
X[1] = CCTCTAGTGATCTTATTCGC,
X[3] = CTGCCAAGGGCCTTTCGGCTGGTAT,
X[5] = CCCAGTTAACGCCAGCGAGGAGGCT, а X[2] и X[4] – случайные последовательности, состоящие из четырех или пяти нуклеотидов. В [738] рассматривались последовательности аналогичной структуры, у которых X[1], X[3], X[5] имели вид
X[1] = GGACTTCGGTCCAGTGCTCGTGCACTAGGCCGTTCGACC,
X[3] = AGGATATGCTTCGGCAGAAGG,
X[5] = CTTAGACAGGAGGTTAGGTGCCTCGTGATGTCCAGTCGC и
X[1] = GGACTTCGGTCCAGTGCTCGTGCACTAGGCCGTTCGACC,
X[3] = ACAGTGAAAAAAGACGTGTGAATGTCACACTGAAAAAA,
X[5] = CTTAGACAGGAGGTTAGGTGCCTCGTGATGTCCAGTCGC, соответственно, а X[2] и X[4] были случайными последовательностями из трех или четырех нуклеотидов. Иногда применяют и довольно большие области. Например, в [253], [304], [316], [534], [764], [870], [980] использовалась область из 120 нуклеотидов,
55
в [783] область состояла из 134 нуклеотидов, а в [571] применялась область из 228 нуклеотидов.
Существенность
размеров
модифицируемых
областей
последовательностей объясняется тем, что для области, состоящей из k нуклеотидов, пространство решений имеет размер 4k. Поэтому при увеличении размеров области экспоненциально моделировании
возрастает для
вычислительная
направленной
эволюции.
нагрузка Кроме
при того,
подготовительном чисто
технически
лабораторное оборудование позволяет использовать от 0.1 до 10 nmol вещества, что соответствует примерно от 421 до 427 последовательностей. Учитывая имеющиеся ограничения по размеру, действия полным перебором весьма нежелательны. Поэтому большое внимание уделяется не только размерам модифицируемых областей, но и другим существенным деталям и ограничениям: расположению
модифицируемой
области
в
последовательности,
отношению
количества нуклеотидов разных видов и т.д. Например, в [324] в качестве исходной была взята последовательность
GGGAGCTCAGAATAAACGCTCAAAGACGGT
GAAACTGAAATCTAATCCGTCTGAACCCTG
GATTTCGACATGAGGCCCGGATCCGGC, состоящая из 87 нуклеотидов, у которой изменялся участок между 24-м и 63-м нуклеотидами, при этом заменялось 30% от общего количества нуклеотидов. Степень изменения исходной последовательности может определяться в зависимости от общего количества нуклеотидов (как в только что рассмотренном примере) или в зависимости от количества нуклеотидов, для которых изменения допустимы. Например, в [163] рассматривались последовательности
CGACGTCGCTCGAATGCTGATAGTAGTTCTCC
TTTAAGGAGTTTGGGTGGTGGGTGGGTGTTAG
56
ATGTTGAGATCGTTAGCATGTTTCGCCGAGCTA и
CGACGTCGCTCGAATGCCGGGCTCGCGTTGCC
GAGGGGGTGGGTTTGGGTCACCACTGGCGTAG
GAAGCCAAGGGTGTGGTGTGCAGCGCCGAGCTA, у которых модифицировались нуклеотиды с 18-го по 79-й с вероятностью 12%. Несколько более простой
подход
рассмотрен, например, в [963]: исходная
последовательность вообще не рассматривалась, а требуемая последовательность строилась в предположении, что начальный отрезок имеет вид
GGGACAGGGCTAGC, заключительный отрезок имеет вид GAGGCAAAGCTTCCG, а по середине расположены 30 случайных нуклеотидов. В [163] применялась направленная эволюция последовательности, у которой начальный отрезок имеет вид
CGACGTCGCTCGAATGC, заключительный отрезок имеет вид
CGCCGAGCTAGAGGTCCTTC,
57
а по середине расположены 70 нуклеотидов, представляющих собой случайную последовательность с примерно равным количеством вхождений A, G, C и T. В [944] применялась направленная эволюция последовательности, у которой начальный отрезок имеет вид
GGTTGGCAGCAGAAGATAGCA, заключительный отрезок имеет вид
GTCGGTCAAGGGAGGGATCCTA, а по середине расположены 60 нуклеотидов, представляющих собой случайную последовательность
с
количеством
вхождений
нуклеотидов
A,
G,
C
и
T,
распределенным в отношении 25/25/30/20. Рассматриваются и более тонкие подходы к организации направленной эволюции. Например, можно взять за основу не случайную последовательность, а уже готовое РНК-устройство. После этого запускается процесс малых изменений, направленный на получение новых полезных свойств с сохранением ранее полученных. В частности, в работе [430] за основу был взят сенсор АТФ:
AGCCAGCTTAATGAGCAAGGGGGTTGCTGGCACCGAAGTG
CCACAGTTTCTTCCCAACCCGGCGTACATGCAACCACTCC. Начальный участок последовательности
AGCCAGCTTAATGAGCAAGG и заключительный участок
GGCGTACATGCAACCACTCC
58
были оставлены без изменений, к заключительному участку была добавлена последовательность
TATAGTGAGTCG TATTACGC, а средний участок
GGGTTGCTGGCACCGAAGTGCCACAGTTTCTTCCCAACCC подвергался
незначительным
модификациям.
Другой
интересный
подход
к
направленной эволюции предложен в работе [963]. Для сенсора
GGGACAGGGCUAGCAGUAGGAUUGGGUGAGGGGAUGUGCUG, полученного обычными методами направленной эволюции, структура слабых связей 1 – 40, 2 – 39, 4 – 37, 5 – 36, 6 – 35, 10 – 33, 11 – 32, 13 – 27, 14 – 26 оказалась интересной с функциональной точки зрения, но не устойчивой. Для закрепления структуры слабых связей такого типа была проведена направленная эволюция, критерием которой выступала стабильность слабых связей. Полученная в результате последовательность сенсора имеет вид:
GGGCUAGGGCUAGCAGUAGGAUUGGGUGAGGGGAUAGCC. При этом в схеме слабых связей пара 1 – 40 была заменена на 3 – 38. Следует отметить, что идея повторной селекции является достаточно распространенной (см., например, [153], [196] – [200], [252], [346], [389], [416], [431], [519], [552], [594], [609]). При этом направленная селекция не обязательно преследует своей целью улучшение уже полученной последовательности. Например, в [433] к уже готовому сенсору была
59
добавлена новая случайная область, после чего процесс направленной эволюции был повторен. Повторная селекция может применяться не только к искусственно синтезированным устройствам, но и к последовательностям РНК природного происхождения (см., например, [508], [656]). Кроме того, в отдельных случаях модификация областей РНК осуществлялась не только с использованием обычных нуклеотидов, но и искусственно синтезированных (см., например, [661], [845]). При этом искусственные нуклеотиды применяются не только для повышения разнообразия случайных последовательностей, но и в чисто технических целях. Например, могут применяться нуклеотиды 5-iodouracil для привлечения методов фотохимии к организации лабораторного процесса (см. [356], [449]). Как правило, механические сенсоры конструируются для обнаружения небольшого фиксированного фрагмента генетической последовательности, который характерен только для последовательностей такого вида и не встречается в других последовательностях. Например, в [112] рассматривается следующий фрагмент, состоящий всего из девятнадцати нуклеотидов (см. также [732]):
AGCGCGTGATGAACTTCGA. Такая
стратегия
наилучшим
образом
работает
для
объектов
распознавания
существенно различающихся между собой. Однако ведутся исследования и в области создания механических сенсоров, позволяющих распознавать и незначительно отличающиеся последовательности. В частности, в [359] предложена конструкция сенсора, разделяющего Human Influenza A virus A/Panama/2007/1999(H3N2) и Human Influenza A virus
A/Aichi/2/1968(H3N2). В случае с Human Influenza A virus
A/Panama/2007/1999(H3N2) и Human Influenza A virus A/Aichi/2/1968(H3N2) оба вируса являются патогенными. Поэтому, вообще говоря, их разделение представляет интерес преимущественно с точки зрения выбора правильного метода лечения, а обнаружение возможно стандартными медицинскими способами. Несколько иная ситуация с Prion Protein (PrP). Этот белок имеет две формы: PrPC и PrPSc [1008]. Форма PrPC является безвредной, но имеет тенденцию к переходу в форму PrPSc. Форма PrPSc вызывает такие заболевания как Creutzfeldt–Jacob disease и Gerstmann–Straussler–Scheinker syndrome
60
(см., например, [1009], [1010]). Известно несколько способов для обнаружения формы PrPSc (см., например, [1011] – [1019]), что позволяет диагностировать указанные выше болезни, но не позволяет диагностировать предрасположенность к ней, поскольку предрасположенность определяется формой PrPC. На сегодняшний день единственным методом для обнаружения формы PrPC является механический сенсор, предложенный в работе [784]. Следует отметить, что в большинстве случаев сенсоры и переключатели, полученные из РНК, представляют собой конструкции, составленные из небольшого количества сравнительно маленьких последовательностей (до нескольких сотен нуклеотидов). Например, в [112] рассмотрены переключатели, один из которых получен из последовательностей
GATCCGGCAAGCTGACCCTGAAGT,
GGTATACTTCAGGGTCAGCTTGCCG,
ATACCAGCCGAAAGGCCCTT,
CTGCCAAGGGCCTTTCGGCT,
GGCAGACTTCAGGGTCAGCTTGCCTTTTTTGGAAA,
AGCTTTTCCAAAAAAGGCAAGCTGACCCTGAAGT, а второй – из последовательностей
GATCCAGCGCGTGATGAACTTCGA,
AGTTCATCACGCGCTG,
ATACCAGCCGAAAGGCCCTTGGCAGTCGAAG,
61
TGAACTTCGACTGCCAAGGGCCTTTCGGCTGGTATTCGA,
TTCATCACGCGCTTTTTTGGA,
AGCTTCCAAAAAAGCGCGTGA. Конструкция сенсоров и переключателей обеспечивает им сравнительно небольшие размеры. Это существенно облегчает создание из таких устройств комплексов для решения более сложных задач. Направленная эволюция предполагает создание устройства лабораторным путем. При этом генетические последовательности, из которых собирается устройство, могут отсутствовать в генетическом коде организма, в котором предполагается функционирование устройства. В работах [546], [711] и [864] предложен подход, заключающийся в поиске кодов устройств непосредственно в геноме, основываясь на общем исследовании функциональных возможностей РНК в зависимости от кода (см., например, [1020] – [1039]). Преимущество такого подхода заключается в том, что вместо размещения в клетке искусственно синтезированных устройств мы можем организовать синтез непосредственно в клетке. Большое
внимание
уделяется
различным
технологиям,
позволяющим
усовершенствовать метод направленной эволюции на лабораторном уровне. При этом возникают различные технологии, представляющие существенный интерес и за пределами задачи организации направленной эволюции. В частности, активно изучаются
вопросы
совершенствования
методов
обеспечения
неподвижности
распознаваемой последовательности (см., например, [110], [154], [179], [354], [368], [444], [445], [483], [504], [507], [508], [530], [534], [553], [560], [643], [656], [748], [750], [762], [772], [783], [870], [884], [914], [950], [951], [954]). При этом если для метода направленной эволюции неподвижность генетической последовательности – это вопрос чистоты лабораторного эксперимента, то в глобальном случае – это вопрос поддержания стабильности в наносистеме. Следует отметить, что отдельные технологии обеспечения лабораторного процесса направленной эволюции выходят за
62
рамки чисто биологических и представляют интерес для разработки гибридных систем (см., например, [267], [356], [449], [599], [643], [648]). Направленная эволюция позволяет отсекать только побочные свойства, обусловленные линейной структурой РНК. Поэтому активно развивается направление, в рамках которого изучаются пространственные свойства уже сконструированных РНК-устройств (см., например, [127], [130], [132], [162], [169], [192], [206], [247], [251], [255], [284], [312], [314], [318], [323], [335], [346], [353], [383], [393], [395] – [398], [402], [431], [446], [454] – [458], [485], [549], [554], [576] – [578], [600], [640], [642], [686], [696], [721] – [723], [740], [746], [764], [776], [824], [854], [855], [874], [887], [898] – [900], [917], [920], [925], [928], [933], [949], [972], [978], [986], [989], [990], [993], [1001]). Для получения точной картины пространственного поведения РНК-устройств существенное внимание приходится уделять исследованию неклассических слабых связей (см., например, [132], [398]). Следует отметить, что не смотря на значительную трудоемкость задачи изучения пространственной структуры РНК, в последние годы наблюдается существенный прогресс в этой области благодаря применению X-ray кристаллографии (см., например, [1040] – [1045]). В работе [480] предложена модель механического сенсора для стероидов. Стартовав с 91014 идентичных последовательностей, после 13 раундов направленной эволюции было получено 19 сенсоров размером от 95 до 100 нуклеотидов. Оказалось, что все 19 последовательностей различны. Последующие исследования (см. [481]) показали, что для распознавания стероидов существенна не сама нуклеотидная последовательность, а ее способность формировать трехвалентный наноузел (см. [1046] – [1050], см. также [1051] – [1054]). В результате в [481] была предложена модель сенсора на основе трехвалентного наноузла, составленного из последовательности
GCAGGGTCAATGGAATTAATGATC
AATTGACAGACGCAAGTCTCCTGC со слабыми связями
63
1 – 48, 2 – 47, 3 – 46, 4 – 45, 5 – 44, 6 – 31, 7 – 30, 8 – 29, 9 – 28, 10 – 27, 11 – 26, 12 – 25, 13 – 24, 14 – 23, 32 – 43, 33 – 42, 34 – 41, 35 – 40. Отметим, что слабая связь 12 – 25 образована неклассической парой G – A. В работе [435] рассмотрены шесть конструкций сенсора, распознающего вирус гепатита С. Все шесть конструкций обладают аналогичной структурой вторичных связей, в рамках которой последовательность РНК имеет вид
X[k,1]Y[k,1]Z[k,1]Y[k,2]Z[k,2]Y[k,3]Z[k,3]Y[k,4]Z[k,4]Y[k,5]
Z[k,5]Y[k,6]Z[k,6]Y[k,7]Z[k,7]Y[k,8]Z[k,8]Y[k,9]X[k,2], где k – номер последовательности. При этом Y[k,1] и Y[k,9], Y[k,2] и Y[k,3], Y[k,4]Y[k,5] и Y[k,6], Y[k,7] и Y[k,8] – пары последовательностей, образующих слабые связи и разделяющих последовательность на свободные участки, комплементарные участки и петли; X[k,1] и X[k,2] – свободные последовательности; Z[k,2], Z[k,4], Z[k,5], Z[k,7] – петли; Z[k,1], Z[k,3], Z[k,6] и Z[k,8] образуют разделенную петлю. Ни для какого из участков структуры вторичных связей совпадения нуклеотидов для всех шести сенсоров нет. Таким образом, здесь, как и в случае [480], существенна не сама нуклеотидная последовательность, а структура вторичных связей. Это говорит о том, что в отдельных случаях можно существенно повысить эффективность направленной эволюции, варьируя не саму случайную последовательность, а возможные структуры вторичных связей. В качестве объекта распознавания в рамках процесса направленной эволюции не обязательно выступают последовательности ДНК или РНК. Имеются механические сенсоры, способные обнаруживать белки, антибиотики, вирусы и т.д. В частности, в [237] предложена конструкция механического сенсора, позволяющего обнаруживать вирус гепатита С. В работах [242], [244], [415] опубликованы результаты исследований по сенсорам, распознающим ионы металлов.
64
Следует
отметить,
что
РНК-сенсоры
обладают
довольно
большими
вычислительными возможностями с точки зрения распознавания языков. В частности, в работе [1055] предложена теоретическая конструкция распознавателя контекстнозависимых языков, основанная на природных принципах взаимодействия молекул РНК. Тот факт, что, обнаруживая запрограммированную эволюцией последовательность, механический сенсор перемещается к ней и прикрепляется на ней, позволяет использовать подобные сенсоры как узлы для конструирования более сложных устройств, которые способны не только распознавать последовательности, но и преобразовывать. В частности, в работе [111] сенсор выступает как конструктивный элемент катализатора, а в [837] сенсор является частью переключателя. Серия работ [1056] – [1062] посвящена WPCR-машинам. Хотя эти машины обладают
довольно
ограниченными
вычислительными
возможностями,
их
существенным достоинством является способность работать параллельно, при этом выполняя различные программы. Теоретический фундамент вычислений на основе самоорганизации был заложен еще в 1963 году в [1063]. Идея использования нанорешеток, построенных из молекул ДНК, для создания различных устройств на основе самоорганизации впервые была высказана в 1982 году в [1064]. В [1065] была предложена модель вычислений на основе нанорешеток. В работах [1066] – [1070] последовало дальнейшее развитие модели, предложенной в [1065], направленное на поиск новых нанорешеток, пригодных
для
вычислений,
расширение
функциональности
модели,
экспериментальное тестирование, исследование сложности нанорешеток и др. В работах [1071] – [1081] были проведены исследования, направленные на отработку отдельных логических элементов и механизмов движения с использованием неавтономных ДНК наномеханических роботов на основе нанорешеток. В частности, были предложены роботы способные осуществлять поворот [1071] – [1073], открытие – закрытие [1074] – [1076], расширение – сжатие [1077] – [1079] и движение [1080], [1081]. В работах [1082] – [1087] предложены различные модели автономных ДНК наномеханических роботов. Первые эксперименты по автономным вычислениям при помощи нанорешеток описаны в [1088] – [1092]. Накопление теоретической базы и практического опыта в области создания устройств с использованием нанорешеток
65
привело к постепенному переходу к разработке полноценных вычислительных устройств. В частности, в работе [1093] предложена конструкция конечного автомата. В [1094] построены конечный автомат, недетерминированный конечный автомат, вероятностный автомат, там же предложена конструкция медицинского робота и модель краулера, перемещающегося по двумерной нанорешетке. В [1095] построена универсальная машина Тьюринга. Отметим,
что
ведутся
разработки
нанороботов,
которые
могут
быть
использованы для строительства ДНК наномеханических устройств или совместной работы с ними. В частности, конструкция наноробота, предназначенного для контроля за процессами в клетке, предложена в [1097]. Активно изучаются вопросы, связанные с разработкой нанороботов с использованием вирусов как доков для роботов, синтетических платформ, наношаблонов и др. (см. [1098] – [1115]). В работе [1116] предложен ДНК наномеханический робот, разработанный на основе бактериальных патогенов Rickettsia rickettsii, предназначенный для управления полимеризацией. В работе [1096] предложена конструкция (см. рисунок 3), которая посредством добавления одной последовательности ДНК запускает каскад преобразований (HCR: hybridization chain reaction). Эта конструкция предполагает наличие некоторого количества заблаговременно размещенных в лабораторной тубе наноструктур двух типов – T и T‘. В лабораторную тубу добавляется последовательность ДНК S. Предполагается, что последовательность S гибридизируется с частью наноструктуры T, освобождая при этом последовательность S‘. В свою очередь последовательность S‘ гибридизируется с частью наноструктуры T‘, освобождая при этом последовательность S. Этот цикл преобразований приводит к связыванию исходной последовательности S с парой наноструктур T и T‘ и освобождению нового экземпляра последовательности S. Этот цикл будет повторяться до тех пор, пока наноструктуры T или T‘ не будут исчерпаны. Такой каскад преобразований может, вообще говоря, протекать либо в соответствии с принципом свободной энергии, либо с применением ферментов, стимулирующих разрыв слабых связей. В частности, в простейшем случае (с модельной точки зрения) все экземпляры последовательности S могут быть полностью идентичны. При этом последовательность
66
S‘ равна S, наноструктуры T и T‘ равны между собой и являются конкатенацией последовательности S и последовательности, комплементарной к ней. В этом случае получающаяся в результате каскада преобразований последовательность является непосредственным повтором последовательности S, образующим двойную спираль с непосредственным повтором комплементарной к ней последовательности. Даже этот весьма простой случай представляет существенный практический интерес. Например, такой каскад преобразований можно использовать в медицине для обнаружения последовательностей фиксированного типа и оценки их количества. Кроме того, синтез периодической последовательности ДНК, получаемой в результате HCR, можно использовать для построения длинных молекул ДНК из фрагментов непосредственно в клетке или лабораторной тубе. Рассматриваемая конструкция каскада имеет два недостатка. Во-первых, нет гарантии зацикливания последовательности преобразований (см. рисунок 4). Вовторых, нет механизма, управляющего направлением распространения процесса в пространстве. Зацикливания
каскадного
процесса
можно
избежать,
если,
например,
использовать в молекулах T и T‘ частично комплементарные участки. Рассмотрим, например, случай, когда
S = AAAAA,
T = TTTTTAACAA, T‘ = TTGTTAAAAA, где нуклеотиды в каждой из последовательностей T и T‘ имеют слабые связи в парах 1 – 10, 2 – 9, 4 – 7, 5 – 6. Гибридизация S и T ведет к уменьшению свободной энергии. Гибридизация освободившегося участка T и T‘ также приводит к уменьшению свободной энергии. Это уменьшение свободной энергии препятствует обращению процесса.
67
Рис.3. Каскад преобразований, предложенный в [1096].
68
Рис.4. Зацикливание каскадного процесса. Только что рассмотренная конструкция предполагает идентичность всех экземпляров T и, соответственно, идентичность всех экземпляров T‘. Если рассмотреть случай, когда используются модифицированные копии T и T‘, то каскадный процесс без повторений можно продолжить на большее количество преобразований. Например,
S = AAAAAAA,
T[1] = TTTTTTTACAAAAA,
69
T‘[1] = TGTTTTTAACAAAA,
T[2] = TTGTTTTAAACAAA,
T‘[2] = TTTGTTTAAAAAAA. При достаточной длине последовательностей S, T и T‘ отсутствия повторений пожно добиться на любом заданном количестве преобразований. Варьируя количество некомплементарных пар можно управлять абсолютными величинами свободных энергий. Создание механизма, управляющего направлением распространения процесса в пространстве, может осуществляться различными путями. Можно выделить две основные группы методов: размещение молекул T и T‘ на геометрически устойчивой конструкции, регулировка плотности расположения молекул T и T‘ в пространстве.
Рис.5. Конструкция 3-6 руки, предложенная в [1117].
70
Рис.6. Нанорешетка, составленная из четырех 3-6 рук. Для регулировки плотности расположения молекул T и T‘ в пространстве можно использовать
различные
методы
для
создания
самоорганизующихся
систем
независимых структур. Например, методы, основанные на генетических алгоритмах или искусственных иммунных системах. Другую возможность дает использование вирусов или нанорешеток в качестве доков. Экспериментально синтезированной нанорешетки, пригодной для выполнения функций дока, пока нет. Однако поставленные к настоящему времени эксперименты показывают, что подобная конструкция принципиально возможна. В частности, за модельную основу можно взять конструкцию куба, состоящего из шести стенок и каркаса. Для стенок дока можно, например, использовать нанорешетку, составленную из 3-6 рук, предложенную в [1117] (см. рисунки 5 и 6). Можно также использовать нанорешетку, построенную по той же схеме, что и нанорешетка на рисунке 6, но с использованием других наноузлов. Например, можно использовать наноузлы, предложенные в работе [1118] (см. рисунок 7). Отметим, что нанорешетка по типу представленной на рисунке 6 с наноузлами, изображенными на рисунке 7, экспериментально конструировалась (см. [1092], см. также [1089]). Размер одной клетки составляет менее 30 nm в одном измерении. Существует технология программирования клеток этой решетки, которая позволяет, в частности, снизить проницаемость клеток (см. [1119]). Следует также отметить, что
71
наноузлы, изображенные на рисунке 7 имеют четыре последовательности ДНК в сечении на протяжении всей конструкции и на каждом из четырех концов (в отличие от двух у 3-6 руки), что существенно облегчает сцепление полученной из них нанорешетки с другими структурами (см., в частности, [1094]).
Рис.7. Конструкция наноузла, предложенная в [1118]. С геометрической точки зрения этот наноузел составлен из девяти последовательностей ДНК и получен наложением четырех последовательностей ДНК, изображенных на рисунке 8.а, и пяти последовательностей ДНК, изображенных на рисунке 8.б.
72
Рис.8.а. Конструктивные элементы нанорешетки, изображенной на рисунке 7.
Рис.8.б. Конструктивные элементы нанорешетки, изображенной на рисунке 7.
73
В качестве остова для конструкции дока можно рассмотреть нанорешетку кубической формы (см., например, [1120]). Например, конструкцию, представленную на рисунке 9.
Рис.9. Нанорешетка в форме куба.
74
Рис.10. Конструктивные элементы нанорешетки, изображенной на рисунке 9. Еще
один
подход
к
организации
взаимодействия
между
молекулами
заключается в создании синтетических генных регуляторных сетей, искусственных биологических систем и генетических булевых автоматов, т.е. схем, в рамках которых взаимодействие между генетическими последовательностями поддерживается при помощи простейших устройств (см., например, [1121] – [1149]). Одна из ключевых проблем нанотехнологий in vivo – распространение процессов между клетками. Хотя на внутриклеточном уровне успехи нанотехнологий довольно
существенны,
большинство
разрабатываемых
роботов
неспособны
перемещаться между клетками. В то же время многие важные для живых систем задачи могут быть решены только при наличии межклеточного взаимодействия. Кроме того,
75
весьма заманчиво выглядит идея размещения наноробота лишь в одной клетке после чего он сам обеспечит свое размножение и распространение по многоклеточному организму. Один из подходов к решению этой проблемы заключается в использовании вирусов и бактерий в качестве носителей нанороботов. Кроме того, для обеспечения перемещения между клетками и межклеточного обмена сигналами можно попытаться использовать гибридные и неорганические нанороботы. Одним из ключей к решению этой проблемы могут стать коллективные ритмы многоклеточных систем. Феномен коллективных ритмов наблюдается у живых организмов на всех уровнях (см., например, [1150] – [1154]). Период коллективных ритмов может колебаться от доли секунды до нескольких лет. Предложено несколько моделей и теорий, объясняющих феномен коллективных ритмов (см. [1151], [1155] – [1172]). Особое направление составляют вопросы исследования коллективных ритмов подвижных клеток (см. [1158], [1162], [1163], [1168], [1171]). Доказано, что межклеточные сигналы в популяции клеток существенны для глобального обмена информацией как у прокариотов, так и у эукариотов (см. [1173], [1174]). Однако сигнальные системы многоклеточных и одноклеточных организмов существенно отличаются (см. [1156], [1172], [1175]). С точки зрения возможности управления межклеточным обменом информацией представляет интерес тот факт, что у всех подвижных клеток межклеточный обмен информацией осуществляется при помощи специальных сигнальных молекул (см. [1158], [1162], [1163], [1168]). Литература
1.
Liu Y., Flood A.H., Bonvallet P.A., Vignon S.A., Northrop B.H., Tseng H.-R., Jeppesen J.O., Huang T.J., Brough B., Baller M., Magonov S., Solares S.D., Goddard W.A., Ho C.-M., Stoddart J.F. // J. Am. Chem. Soc. 2005. V.127. P.9745.
2.
Berna J., Leigh D.A., Lubomska M., Mendoza S.M., Perez E.M., Rudolf P., Teobaldi G., Zerbetto F. // Nat. Mater. 2005. V.4. P.704.
3.
Eelkema R., Pollard M.M., Vicario J., Katsonis N., Ramon B.S., Bastiaansen C.W.M., Broer D.J., Feringa B.L. // Nature. 2006. V.440. P.163.
76
4.
Schoevaars A. M. et al. Toward a switchable molecular rotor // J. Org. Chem. 1997. V.62. P.4943-4948.
5.
Koumura N., Zijlstra R.W.J., van Delden R.A., Harada N., Feringa B.L. Lightdriven monodirectional molecular rotor // Nature. 1999. V.401. P.152-155.
6.
Pollard M.M., Klok M., Pijper D., Feringa B.L. Rate Acceleration of Light-Driven Rotary Molecular Motors // Adv. Funct. Mater. 2007. V.17. P.718–729.
7.
Yang X., Wenzler L.A., Qi J., Li X., Seeman N.C. Ligation of DNA Triangles Containing Double Crossover Molecules // Journal of the American Chemical Society. 1998. V.120. P.9779-9786.
8.
Seeman N.C. DNA Nicks and Nodes and Nanotechnology // NanoLetters. 2001. V.1. P.22-26.
9.
Clayden J., Pink J. H. Concerted rotation in a tertiary aromatic amide: towards a simple molecular gear // Angew. Chem. Int. Edn Engl. 1998. V.37. P.1937-1939.
10.
Huck N.P.M., Jager W.F., de Lange B., Feringa B.L. Dynamic control and amplification of molecular chirality by circularly polarized light // Science. 1996. V.273. P.1686-1688.
11.
Beyer S., Nickels P., Simmel F.C. Periodic DNA Nanotemplates Synthesized by Rolling Circle Amplification // NanoLetters. 2005. V.5. P.719-722.
12.
Bissell S. A., Cordova E., Kaifer A. E., Stoddart J.F. A chemically and electrochemically switchable molecular shuttle // Nature. 1994. V.369. P.133-136.
13.
Balzani V., Credi A., Raymo F.M., Stoddart J.F. // Angew. Chem. Int. Ed. 2000. V.39. P.3348.
14.
Special Issue on Molecular Machines. Acc. Chem. Res. 2001. V.34.
15.
Special Volume on Molecular Machines and Motors. Struct. Bond. 2001. V.99.
16.
Balzani V., Credi A., Venturi M. Molecular Devices and Machines—A Journey into the Nano World. Wiley-VCH, Weinheim, 2003.
17.
Elizarov A.M., Chiu S.H., Stoddart J.F. // J. Org. Chem. 2002. V.67. P.9175.
18.
Tseng H.R., Vignon S.A., Stoddart J.F. // Angew. Chem. Int. Ed. 2003. V.42. P.1491.
19.
Keaveney C.M., Leigh D.A. // Angew. Chem. Int. Ed. 2004. V.43. P.1222.
20.
Leigh D.A., Perez E.M. // Chem. Comm. 2004. P.2262.
77
21.
Ashton P.R., Ballardini R., Balzani V., Baxter I., Credi A., Fyfe M.C.T., Gandolfi M.T., Gomez-Lopez M., Martinez-Diaz M.V., Piersanti A., Spencer N., Stoddart J.F., Venturi M., White A.J.P., Williams D.J. Acid-base controllable molecular shuttles // J. Am. Chem. Soc. 1998. V.120. P.11932-11942.
22.
Tseng H.R., Vignon S.A., Celestre P.C., Perkins J., Jeppesen J.O., Di Fabio A., Ballardini R., Gandolfi M.T., Venturi M., Balzani V., Stoddart J.F. // Chem. Eur. J. 2004. V.10. P.155.
23.
Altieri A., Gatti F.G., Kay E.R., Leigh D.A., Martel D., Paolucci F., Slawin A.M.Z., Wong J.K.Y. // J. Am. Chem. Soc. 2003. V.125. P.8644.
24.
Willner I., Pardo-Yssar V., Katz E., Ranjit K.T. // J. Electroanal. Chem. 2001. V.497. P.172.
25.
Wang Q.C., Qu D.H., Ren J., Chen K.C., Tian H. // Angew. Chem. Int. Ed. 2004. V.43. P.2661.
26.
Abraham W., Grubert L., Grummt U.W., Buck K. // Chem. Eur. J. 2004. V.10. P.3562.
27.
Bedard T.C., Moore J.S. Design and synthesis of a ―molecular turnstile‖ // J. Am. Chem. Soc. 1995. V.117. P.10662-10671.
28.
Kelly T.R., Tellitu I., Sestelo J.P. In search of molecular ratchets // Angew. Chem. Int. Ed. Engl. 36, 1866-1868 (1997).
29.
Yurke B., Turberfield A.J., Mills A.P., Simmel F.C., Neumann J.L. A DNAfuelled molecular machine made of DNA // Nature. 2001. V.415. P.62–65.
30.
Simmel F.C., Yurke B. A DNAbased molecular device switchable between three distinct mechanical states // Appl. Phys. Lett. 2002. V.80. P.883–885.
31.
Mitchell J.C., Yurke B. DNA scissors // DNA Computing. Proc. 7th Int. Meet. DNA-Based Computers, ed. S.N.Jonoska, N.Seeman. Univ. So. FL, Tampa. Heidelberg: Springer Verlag, 2002.
32.
Badjic J.D., Balzani V., Credi A., Silvi S., Stoddart J.F. // Science. 2004. V.303. P.1845.
33.
Persson B., Stenhag K., Nilsson P., Larsson A., Uhlen M., Nygren P. Analysis of oligonucleotide probe affinities using surface plasmon resonance: a means for mutational scanning // Anal. Biochem. 1997. V.246. P.34-44.
78
34.
Sauer M., Brecht A., Charisse K., Maier M., Gerster M., Stemmler I., Gauglitz G., Bayer E. Interaction of chemically modified antisense oligonucleotides with sense DNA: a label-free interaction study with reflectometric interference spectroscopy // Anal. Chem. 1999. V.71. P.2850-2857.
35.
Peterson A.W., Wolf L.K., Georgiadis R.M. Hybridization of mismatched or partially matched DNA at surfaces // J. Am. Chem. Soc. 2002. V.124. P.14601-14607.
36.
Nelson B.P., Grimsrud T.E., Liles M.R., Goodman R.M., Corn R.M. Surface plasmon resonance imaging measurements of DNA and RNA hybridization adsorption onto DNA microarrays // Anal. Chem. 2001. V.73. P.1-7.
37.
Watts H.J., Yeung D., Parkes H. Real-time detection and quantification of DNA hybridization by an optical biosensor // Anal. Chem. 1995. V.67. P.4283-4289.
38.
Wang J. Electrochemical nucleic acid biosensors // Anal. Chim. Acta. 2002. V.469. P.63-71.
39.
Hook F., Ray A., Norden B., Kasemo B. Characterization of PNA and DNA immobilization and subsequent hybridization with DNA using acoustic-shear-wave attenuation measurements // Langmuir. 2001. V.17. P.8305-8312.
40.
Yu F., Yao D., Knoll W. Oligonucleotide hybridization studied by a surface plasmon diffraction sensor (SPDS) // Nucleic Acids Res. 2004. V.32. P.75-81.
41.
Backmann N., Zahnd C., Huber F., Bietsch A., Pluckthun A., Lang H., Guntherodt H., Hegner M., Gerber C. A label-free immunosensor array using single-chain antibody fragments // Proc. Natl. Acad. Sci. USA. 2005. V.102. P.14587–14592
42.
Fritz J., Cooper E.B., Gaudet S., Sorger P.K., Manalis S.R. Electronic detection of DNA by its intrinsic molecular charge // Proc. Natl. Acad. Sci. USA. 2002. V.99. P.14142–14146.
43.
Gfeller K.Y., Nugaeva N., Hegner M. Rapid Biosensor for Detection of Antibiotic-Selective Growth of Escherichia coli // Applied and Environmental Microbiology. 2005, V.71. P.2626–2631.
44.
Fritz J., Baller M.K., Lang H.P., Rothuizen H., Vettiger P., Meyer E., Guntherodt H.J., Gerber C., Gimzewski J.K. Translating biomolecular recognition into nanomechanics // Science. 2000. V.288. P.316-318.
79
45.
Liu W., Montana V., Chapman E.R., Mohideen U., Parpura V. Botulinum toxin type B micromechanosensor // Proc. Natl. Acad. Sci. USA. 2003. V.100. P.13621– 13625.
46.
McKendry R., Zhang J., Arntz Y., Strunz T., Hegner M., Lang H., Baller M.K., Certa U., Meyer E., Guntherodt H., Gerber C. Multiple label-free biodetection and quantitative DNA-binding assays on a nanomechanical cantilever array // Proc. Natl. Acad. Sci. USA. 2002. V.99. P.9783–9788.
47.
Lang H.P., Berger R., Andreoli C., Brugger J., Despont M., Vettiger P., Gerber C., Ramseyer J.P., Meyer E., Guntherodt H.-J. Sequential position readout from arrays of micromechanical cantilever sensors // Appl. Phys. Lett. 1998. V.72. P.383–385.
48.
Cornell B.A. et al. // Nature. 1997. V.387. P.580.
49.
Boon E.M., Ceres D.M., Drummond T.G., Hill M.G., Barton J.K. // Nature Biotechnol. 2000. V.18. P.1096.
50.
Gu L.-Q., Cheley S., Bayley H. // Science. 2001. V.291. P.636.
51.
Willner I., Katz E. // Angew. Chem. Int. Ed. 2000. V.39. P.1180.
52.
Schutz S. et al. // Sens. Actuators B. 2000. V.65. P.291.
53.
Gopel W. // Sens. Actuators B. 1998. V.52. P.125.
54.
Marvin J.S. et al. // Proc. Natl. Acad. Sci. USA. 1997. V.94. P.4366.
55.
Marvin J.S., Hellinga H.W. // J. Am. Chem. Soc. 1998. V.120. P.7.
56.
Marvin J.S., Hellinga H.W. // Proc. Natl. Acad. Sci. USA. 2001. V.98. P.4955.
57.
Cheng Q., Stevens R.C. // Adv. Mater. 1997. V.9. P.481.
58.
Shen Y., Safinya C.R., Liang K.S., Ruppert A.F., Rothschild K.J. // Nature. 1993. V.366. P.48.
59.
Tang Y., Dave B.C. // Adv. Mater. 1998. V.10. P.1536.
60.
Chemla Y.R. et al. // Proc. Natl. Acad. Sci. USA. 2000. V.97. P.14268.
61.
Edlestein R.L. et al. // Biosens. Bioelectron. 2000. V.14. P.805.
62.
Balzani V., Credi A., Raymo F.M., Stoddart J.F. // Angew. Chem. Int. Ed. 2000. V.39. P.3348.
63.
Feringa B.L., van Delden R.A., Koumura N., Geertsema E.M. // Chem. Rev. 2000. V.100. P.1789.
80
64.
Collin J.P., Gavina P., Heitz V., Sauvage J.P. // Eur. J. Inorg. Chem. 1998. V.1998. P.1.
65.
Lehn J.M. Supramolecular Chemistry: Concepts and Perspectives. Wiley-VCH, Weinheim, 1995.
66.
Hugel T., Holland N.B., Cattani A., Moroder L., Seitz M., Gaub H.E. SingleMolecule Optomechanical Cycle // Science. 2002. V.296. P.1103-1106.
67.
Hartley G.S. // Nature. 1997. V.140. P.281.
68.
Rau H. // Photochromism: Molecules and Systems, H.Dufirr, H.Bouas-Laurent, Eds. Elsevier, Amsterdam, 1990, chap. 4.
69.
Shinkai S., Manabe O. // Top. Curr. Chem. 1984. V.121. P.76.
70.
Willner I. // Acc. Chem. Res. 1997. V.30. P.347.
71.
Ulysse L., Cubillos J., Chmielewski J. // J. Am. Chem. Soc. 1995. V.117. P.8466.
72.
Asanuma H., Ito T., Yoshida T., Liang X., Komiyama M. // Angew. Chem. Int. Ed. 1999. V.38. P.2393.
73.
Feringa B.L., Jager W.F., de Lange B. // Tetrahedron. 1993. V.49. P.8267.
74.
Tamai N., Miyasaka H. // Chem. Rev. 2000. V.100. P.1875.
75.
Kumar G.S., Neckers D.C. // Chem. Rev. 1989. V.89. P.1915.
76.
Irie M. // Adv. Polym. Sci. 1990. V.94. P.27.
77.
Vogtle F. // Supramolecular Chemistry. Wiley, New York, 1991.
78.
Wurthner F., Rebek Jr. J. // J. Chem. Soc. Perkin Trans. 1995. V.2. P.1727.
79.
Archut A., Azzellini G.C., Balzani V., De Cola L., Vogtle F. // J. Am. Chem. Soc. 1998. V.120. P.12187.
80.
Eisenbach C.D. // Polymer. 1980. V.21. P.1175.
81.
Blair H.S., Pogue H.I., Riordan E. // Polymer. 1980. V.21. P.1195.
82.
Strzegowski L.A., Martinez M.B., Gowda D.C., Urry D.W., Tirrell D.A. // J. Am. Chem. Soc. 1994. V.116. P.813.
83.
Lagugne F. et al. // Phys. Chem. Chem. Phys. 2000. V.2. P.5154.
84.
Monti S., Orlandi G., Palmieri P. // Chem. Phys. 1982. V.71. P.87.
85.
Rau H. // J. Photochem. 1984. V.26. P.221.
86.
Nagele T., Hoche R., Zinth W., Wachtveitl J. // Chem. Phys. Lett. 1997. V.272. P.489.
81
87.
Renner C., Cramer J., Behrendt R., Moroder L. // Biopolymers. 2000. V.54. P.501.
88.
Behrendt R. et al. // Angew. Chem. Intl. Ed. 1999. V.38. P.2771.
89.
Mao C., Sun W., Shen Z., Seeman N.C. A DNA Nanomechanical Device Based on the B-Z Transition // Nature. 1999. V.397. P.144-146.
90.
Niemeyer C.M., Adler M., Lenhert S., Gao S., Fuchs H., Chi L.F. // ChemBioChem. 2001. V.2. P.260-265.
91.
Kruger K., Grabowski P.J., Zaug A.J., Sands J., Gottschling D.E., Cech T.R. Selfsplicing RNA: autoexcision and autocyclization of the ribosomal RNA intervening sequence of Tetrahymena // Cell. 1982. V.31. P.147-157.
92.
Guerrier-Takada C., Gardiner K., Marsh T., Pace N., Altman S. The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme // Cell. 1983. V.35. P.849-857.
93.
Bass B.L., Cech T.R. Specific interaction between the self-splicing RNA of Tetrahymena and its guanosine substrate: implications for biological catalysis by RNA // Nature. 1984. V.308. P.820-826.
94.
O'Malley R.P., Mariano T.M., Siekierka J., Mathews M.B. A mechanism for the control of protein synthesis by adenovirus VA RNAI // Cell. 1986. V.44. P.391-400.
95.
Schneider T.D., Stormo G.D., Gold L., Ehrenfeucht A. Information content of binding sites on nucleotide sequences // J. Mol. Biol. 1986. V.188. P.415–431.
96.
Cech T.R. The chemistry of self-splicing RNA and RNA enzymes // Science. 1987. V.236. P.1532-1539.
97.
Gyllensten U.B., Erlich H.A. Generation of single-stranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus // Proc. Natl. Acad. Sci. USA. 1988. V.85. P.7652-7656.
98.
Cullen B.R., Greene W.C. Regulatory pathways governing HIV-1 replication // Cell. 1989. V.58. P.423-426.
99.
Milligan J.F., Uhlenbeck O.C. Synthesis of small RNAs using T7 RNA polymerase // Meth. Enzymol. 1989. V.180. P.51–62.
100.
Marciniak
R.A.,
Garcia-Blanco
M.A.,
Sharp
P.A.
Identification
and
characterization of a HeLa nuclear protein that specifically binds to the transactivation-response (TAR) element of human immunodeficiency virus // Proc. Natl. Acad. Sci. USA. 1990. V.87. P.3624-3628.
82
101.
Green R., Ellington A.D., Szostak J.W. In vitro genetic analysis of the
Tetrahymena self-splicing intron // Nature. 1990. V.347. P.406-408. 102.
Sullenger B.A., Gallardo H.F., Ungers G.E., Gilboa E. Overexpression of TAR
sequences renders cells resistant to human immunodeficiency virus replication // Cell. 1990. V.63. P.601-608. 103.
Ellington A.D., Szostak J.W. In vitro selection of RNA molecules that bind
specific ligands // Nature. 1990. V.346. P.818–822. 104.
Tuerk C., Gold L. Systematic evolution of ligands by exponential enrichment:
RNA ligands to bacteriophage T4 DNA polymerase // Science. 1990. V.249. P.505– 510. 105.
Robertson D.L., Joyce G.F. Selection in vitro of an RNA enzyme that specifically
cleaves single-stranded DNA // Nature. 1990. V.344. P.467-468. 106.
Achenbach J.C., Nutiu R., Li Y. Structure-switching allosteric deoxyribozymes //
Anal. Chim. Acta. 2005. V.534. P.41-51. 107.
Agresti J.J., Kelly B.T., Jaschke A., Griffiths A.D. Selection of ribozymes that
catalyse
multiple-turnover
Diels-Alder
cycloadditions
by
using
in
vitro
compartmentalization // Proc. Natl. Acad. Sci. USA. 2005. V.102. P.16170-16175. 108.
Aldaz-Carroll L., Tallet B., Dausse E., Yurchenko L., Toulmé J.J. Apical
loopinternal loop interactions: a new RNA-RNA recognition motif identified through in vitro selection against RNA hairpins of the hepatitis C virus mRNA // Biochemistry. 2002. V.41. P.5883-5893. 109.
Allen R.S., Millgate A.G., Chitty J.A., Thisleton J., Miller J.A., Fist A.J., Gerlach
W.L., Larkin P.J. RNAi-mediated replacement of morphine with the nonnarcotic alkaloid reticuline in opium poppy // Nat. Biotechnol. 2004. V.22. P.1559–1566. 110.
Allen P., Worland S., Gold L. Isolation of high-affinity RNA ligands to HIV-1
integrase from a random pool // Virology. 1995. V.209. P.327-336. 111.
Amontov S., Jäschke A. Controlling the rate of organic reactions: rational design
of allosteric Diels-Alderase ribozymes // Nucleic Acids Research. 2006. V.34. P.50325038.
83
112.
An C.I., Trinh V.B., Yokobayashi Y. Artificial control of gene expression in
mammalian cells by modulating RNA interference through aptamer–small molecule interaction // RNA. 2006. V.12. P.710–716. 113.
Anderson P.C., Mecozzi S. Unusually short RNA sequences: design of a 13-mer
RNA that selectively binds and recognizes theophylline // J. Am. Chem. Soc. 2005. V.127. P.5290-5291. 114.
Anderson P.C., Mecozzi S. Identification of a 14mer RNA that recognizes and
binds flavin mononucleotide with high affinity // Nucleic Acids Res. 2005. V.33. P.6992-6999. 115.
Andreola M.L., Pileur F., Calmels C., Ventura M., Tarrago-Litvak L., Toulme J.J.,
Litvak S. DNA aptamers selected against the HIV-1 RNase H display in vitro antiviral activity // Biochemistry. 2001. V.40. P.10087–10094. 116.
Araki M., Okuno Y., Hara Y., Sugiura Y. Allosteric regulation of a ribozyme
activity through ligand-induced conformational change // Nucleic Acids Res. 1998. V.26. P.3379–3384. 117.
Arnold F.H., Blanch H.W. Analytical affinity chromatography II. Rate theory and
the measurement of biological binding kinetics // J. Chromatogr. 1986. V.355. P.13– 27. 118.
Arnold F.H., Schofield S.A., Blanch H.W. Analytical affinity chromatography. I.
Local equilibrium theory and the measurement of assocation and inhibition constants // J. Chromatogr. 1986. V.355. P.1-12. 119.
Atsumi S., Ikawa Y., Shiraishi H., Inoue T. Design and development of a catalytic
ribonucleoprotein // EMBO J. 2001. V.20. P.5453-5460. 120.
Babendure J.R., Adams S.R., Tsien R.Y. Aptamers switch on fluorescence of
triphenylmethane dyes // J. Am. Chem. Soc. 2003. V.125. P.14716-14717. 121.
Bae S.-J., Oum J.-H., Sharma S., Park J., Lee, S.-W. In vitro selection of specific
RNA inhibitors of NFATc // Biochem. Biophys. Res. Commun. 2002. V.298. P.486– 492. 122.
Bagga P.S., Wilusz J. Northwestern screening of expression libraries // Methods
Mol. Biol. 1999. V.118. P.245–256.
84
123.
Baig T.T., Lanchy J.-M., Lodmell J.S. HIV-2 RNA dimerization is regulated by
intramolecular interactions in vitro // RNA. 2007. V.13. P.1341-1354. 124.
Bartel D.P., Szostak J.W. Isolation of new ribozymes from a large pool of random
sequences // Science. 1993. V.261. P.1411–1418. 125.
Bartel D.P., Unrau P.J. Constructing an RNA world // Trends Cell Biol. 1999. V.9.
P.M9–M13. 126.
Baskerville S., Bartel D.P. A ribozyme that ligates RNA to protein // Proc. Natl.
Acad. Sci. USA. 2002. V.99. P.9154-9159. 127.
Baskerville S., Zapp M., Ellington A.D. Anti-Rex aptamers as mimics of the
Rexbinding element // J. Virol. 1999. V.73. P.4962-4971. 128.
Basnar B., Elnathan R., Willner I. Following aptamer-thrombin binding by force
measurements // Anal. Chem. 2006. V.78. P.3638-3642. 129.
Batey R.T., Gilbert S.D., Montange R.K. Structure of a natural guanine-responsive
riboswitch complexed with the metabolite hypoxanthine // Nature. 2004. V.432. P.411–415. 130.
Batey R.T., Rambo R.P., Doudna J.A. // Angew. Chem. Int. Ed. Engl. 1999. V.38.
P.2326. 131.
Battersby T.R., Ang D.N., Burgstaller P., Jurczyk S.C., Bowser M.T., Buchanan
D.D., Kennedy, R.T., Benner, S.A. Quantitative Analysis of Receptors for Adenosine Nucleotides Obtained via In Vitro Selection from a Library Incorporating a Cationic Nucleotide Analog // J. Am. Chem. Soc. 1999. V.121. P.9781-9789. 132.
^Battiste J.L., et al. // Science. 1996. V.273. P.1547.
133.
Baugh C., Grate D., Wilson C. 2.8 Å crystal structure of the malachite green
aptamer // J. Mol. Biol. 2000. V.301. P.117-128. 134.
Bayer T.S., Smolke C.D. Programmable ligand-controlled riboregulators of
eukaryotic gene expression // Nat. Biotechnol. 2005. V.23. P.337–343. 135.
Beaudry A., DeFoe J., Zinnen S., Burgin A., Beigelman L. In vitro selection of a
novel nuclease-resistant RNA phosphodiesterase // Chem. Biol. 2000. V.7. P.323-334. 136.
Becht P., Vollmeister E., Feldbrügge M. A role for RNA-binding proteins
implicated in pathogenic development of Ustilago maydis // Eukaryot. Cell. 2005. V.4. P.121–133.
85
137.
Becht P., König J., Feldbrügge M. The RNA-binding protein Rrm4 is essential for
polarity in Ustilago maydis and shuttles along microtubules // J. Cell Sci. 2006. V.119. P.4964–4973. 138.
Been M.D., Perrotta A.T. Group I intron self-splicing with adenosine: evidence for
a single nucleoside-binding site // Science. 1991. V.252. P.434–437. 139.
Beigelman L., McSwiggen J.A., Draper K.G., Gonzalez C., Jensen K., Karpeisky
A.M., Modak A.S., Matulic-Adamic J., DiRenzo A.B., Haeberli P., et al. Chemical modification of hammerhead ribozymes. Catalytic activity and nuclease resistance // J. Biol. Chem. 1995. V.270. P.25702-25708. 140.
Bell C., Lynam E., Landfair D.J., Janjic N., Wiles M.E. Oligonucleotide NX1838
inhibits VEGF165-mediated cellular responses in vitro // In Vitro Cell Dev. Biol. Anim. 1999. V.35. P.533-542. 141.
Berens C., Thain A., Schroeder R. A tetracycline-binding RNA aptamer // Bioorg.
Med. Chem. 2001. V.9. P.2549–2556. 142.
Berezovski M., Drabovich A., Krylova S.M., Musheev M., Okhonin V., Petrov A.,
Krylov S.N. Nonequilibrium capillary electrophoresis of equilibrium mixtures: a universal tool for development of aptamers // J. Am. Chem. Soc. 2005. V.127. P.31653171. 143.
Berezovski M., Musheev M., Drabovich A., Krylov S.N. Non-SELEX selection of
aptamers // J. Am. Chem. Soc. 2006. V.128. P.1410–1411. 144.
Bergeron L.J., Perreault J.P. Target-dependent on/off switch increases ribozyme
fidelity // Nucleic Acids Res. 2005. V.33. P.1240–1248. 145.
Bergman N.H., Johnston W.K., Bartel D.P. Kinetic framework for ligation by an
efficient RNA ligase ribozyme // Biochemistry. 2000. V.39. P.3115–3123. 146.
Bernstein D.S., Buter N., Stumpf C., Wickens M. Analyzing mRNA-protein
complexes using a yeast three-hybrid system // Methods. 2002. V.26. P.123–141. 147.
Bernstein D., Hook B., Hajarnavis A., Opperman L., Wickens M. Binding
specificity and mRNA targets of a C. elegans PUF protein, FBF-1 // RNA. 2005. V.11. P.447–458. 148.
Bevilacqua P.C., Yajima R. Nucleobase catalysis in ribozyme mechanism // Curr.
Opin. Chem. Biol. 2006. V.10. P.455-464.
86
149.
Beyer S., Dittmer W.U., Simmel F.C. Design Variations for an Aptamer-Based
DNA Nanodevice // Journal of Biomedical Nanotechnology. 2005. V.1. P.96–101. 150.
Beyer S., Simmel F.C.A modular DNA signal translator for the controlled release
of a protein by an aptamer // Nucleic Acids Research. 2006. V.34. P.1581–1587. 151.
Bianchini M., Radrizzani M., Brocardo M.G., Reyes G.B., Solveyra C.G., Santa–
Coloma A. Specific oligobodies against ERK-2 that recognize both the native and the denatured state of the protein // J. Immunol. Methods. 2001. V.252. P.191-197. 152.
Bieling P., Beringer M., Adio S., Rodnina M.V. Peptide bond formation does not
involve acid-base catalysis by ribosomal residues // Nat. Struct. Mol. Biol. 2006. V.13. P.423-428. 153.
Biesecker G., Dihel L., Enney K., Bendele R.A. Derivation of RNA aptamer
inhibitors of human complement C5 // Immunopharmacology. 1999. V.42. P.219-230. 154.
Binkley J., Allen P., Brown D.M., Green L., Tuerk C., Gold L. RNA ligands to
human nerve growth factor // Nucleic Acids Res. 1995. V.23. P.3198-3205. 155.
Birikh K.R., Heaton P.A., Eckstein F. // Eur. J. Biochem. 1997. V.245. P.1–16.
156.
Biroccio A., Hamm J., Incitti I., De Francesco R., Tomei L. Selection of RNA
aptamers that are specific and high-affinity ligands of the hepatitis C virus RNAdependent RNA polymerase // J. Virol. 2002. V.76. P.3688–3696. 157.
Bishop J.S., Guy-Caffey J.K., Ojwang J.O., Smith S.R., Hogan M.E., Cossum
P.A., Rando R.F., Chaudhary N. Intramolecular G-quartet motifs confer nuclease resistance to a potent anti-HIV oligonucleotide // J. Biol. Chem.. 1996. V.271. P.5698–5703. 158.
Blank M., Blind M. Aptamers as tools for target validation // Curr. Opin. Chem.
Biol. 2005. V.9. P.336. 159.
Blank M., Weinschenk T., Priemer M., Schluesener H. Systematic evolution of a
DNA aptamer binding to rat brain tumor microvessels. Selective targeting of endothelial regulatory protein pigpen // J. Biol. Chem. 2001. V.276. P.16464-16468. 160.
Blind M., Kolanus W., Famulok M. Cytoplasmic RNA modulators of an inside-out
signal-transduction cascade // Proc. Natl. Acad. Sci. USA. 1999. V.96. P.3606-3610.
87
161.
Blouin S., Lafontaine D.A. A loop–loop interaction and a K-turn motif located in
the lysine aptamer domain are important for the riboswitch gene regulation control // RNA. 2007. V.13. P.1256-1267. 162.
Bock L.C., Griffin L.C., Latham J.A., Vermaas E.H., Toole J.J. Selection of
singlestranded DNA molecules that bind and inhibit human thrombin // Nature. 1992. V.355. P.564-566. 163.
Boese B.J., Breaker R.R. In vitro selection and characterization of cellulose-
binding DNA aptamers // Nucleic Acids Research. 2007. V.35. P.6378-6388. 164.
Bogenhagen D.F., Brown D.D. Nucleotide sequences in Xenopus 5S DNA
required for transcription termination // Cell. 1981. V.24. P.261–270. 165.
Boiziau C., Dausse E., Mishra R., Duconge F., Toulme J.J. Identification of
aptamers against the DNA template for in vitro transcription of the HIV-1 TAR element // Antisense Nucleic Acid Drug Dev. 1997. V.7. P.369-380. 166.
Boiziau C., Dausse E., Yurchenko L., Toulme J.J. DNA aptamers selected against
the HIV-1 trans-activation-responsive RNA element form RNA-DNA kissing complexes // J. Biol. Chem. 1999. V.274. P.12730–12737. 167.
Bokman S.H., Ward W.W. Renaturation of Aequorea green-fluorescent protein //
Biochem. Biophys. Res. Commun. 1981. V.101. P.1372-1380. 168.
Bondensgaard K., Mollova E.T., Pardi A. The global conformation of the
hammerhead ribozyme determined using residual dipolar couplings // Biochemistry. 2002. V.41. P.11532–11542. 169.
Borer P.N. et al. // Biochemistry. 1995. V.34. P.6488.
170.
Braasch D.A., Corey D.R. Locked nucleic acid (LNA): fine-tuning the recognition
of DNA and RNA // Chem. Biol. 2000. V.55. P.1–7. 171.
Bradford M.M. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding // Anal. Biochem. 1976. V.72. P.248–254. 172.
Breaker R.R. In Vitro Selection of Catalytic Polynucleotides // Chem. Rev. 1997.
V.97. P.371-390. 173.
Breaker R.R. Engineered allosteric ribozymes as biosensor components // Curr.
Opin. Biotechnol. 2002. V.13. P.31–39.
88
174.
Breaker R.R. DNA aptamers and DNA enzymes // Curr. Opin. Chem. Biol. 1997.
V.1. P.26–31. 175.
Breaker R.R. Riboswitches and the RNA World // The RNA World—Gesteland
RF. Cech T.R., Atkins J.F., eds. 3rd. Cold Spring Harbor, NY, USA: Cold Spring Harbor Laboratory Press, 2006. 176.
Breaker R.R., Joyce G.F. Inventing and improving ribozyme function—rational
design versus iterative selection methods // Trends Biotechnol. 1994. V.12. P.268– 275. 177.
Breaker R.R., Joyce G.F. A DNA enzyme that cleaves RNA // Chem. Biol. 1994.
V.1. P.223-229. 178.
Breaker R.R., Joyce G.F. A DNA enzyme with Mg2+-dependent RNA
phosphoesterase activity // Chem. Biol. 1995. V.2. P.655-660. 179.
Bridonneau P., Chang Y.F., O'Connell D., Gill S.C., Snyder D.W., Johnson L.,
Goodson T., Jr., Herron D.K., Parma D.H. High-affinity aptamers selectively inhibit human nonpancreatic secretory phospholipase A2 (hnps-PLA2) // J. Med. Chem. 1998. V.41. P.778-786. 180.
Brockstedt U., Uzarowska A., Montpetit A., Pfau W., Labuda D. In vitro evolution
of RNA aptamers recognizing carcinogenic aromatic amines // Biochem. Biophys. Res. Commun. 2004. V.313. P.1004–1008. 181.
Brody E.N., Gold L. Aptamers as therapeutic and diagnostic agents // J.
Biotechnol. 2000. V.74. P.5–13. 182.
Brody E.N., Willis M.C., Smith J.D., Jayasena S., Zichi D., Gold L. The use of
aptamers in large arrays for molecular diagnostics // Mol. Diagn. 1999. V.4. P.381– 388. 183.
Brooijmans N., Sharp K.A., Kuntz I.D. Stability of macro-molecular complexes //
Proteins. 2002. V.48. P.645–653. 184.
Bruesehoff P.J., Li J., Augustine A.J., 3rd, Lu Y. Improving metal ion specificity
during in vitro selection of catalytic DNA // Comb. Chem. High Throughput Screen. 2002. V.5. P.327-335. 185.
Brummelkamp T.R., Bernards R., Agami R. A system for stable expression of
short interfering RNAs in mammalian cells // Science. 2002. V.296. P.550–553.
89
186.
Bruno J.G., Kiel J.L. In vitro selection of DNA aptamers to anthrax spores with
electrochemiluminescence detection // Biosens. Bioelectron. 1999. V.14. P.457-464. 187.
Bryant K.F., Cox J.C., Wang H., Hogle J.M., Ellington A.D., Coen D.M. Binding
of herpes simplex virus-1 US11 to specific RNA sequences // Nucleic Acids Res. 2005. V.33. P.6090-6100. 188.
Buck J., Furtig B., Noeske J., Wohnert J., Schwalbe H. Time-resolved NMR
methods resolving ligand-induced RNA folding at atomic resolution // PNAS. 2007. V.104. P.15699–15704. 189.
Bunka D.H.J., Mantle B.J., Morten I.J., Tennent G.A., Radford S.E., Stockley P.G.
Production and Characterization of RNA Aptamers Specific for Amyloid Fibril Epitopes // J. Biol. Chem. 2007. V.282. P.34500-34509. 190.
Bunka D.H.J., Stockley P.G. Aptamers come of age—at last! // Nat. Rev.
Microbiol. 2006. V.44. P.589–596. 191.
Burge S., Parkinson G.N., Hazel P., Todd A.K., Neidle S. Quadruplex DNA:
sequence, topology and structure // Nucleic Acids Res. 2006. V.34. P.5402–5415. 192.
Burgstaller P., Famulok M. Isolation of RNA–aptamers for biological cofactors by
in vitro selection // Angew. Chem. Int. Ed. Engl. 1994. V.33. P.1084–1087. 193.
Burgstaller P., Famulok M. Structural characterization of a flavin-specific RNA
aptamer by chemical probing // Bioorg. Med. Chem. Lett. 1996. V.6. P.1157-1162. 194.
Burgstaller P., Jenne A., Blind M. Aptamers and aptazymes: accelerating small
molecule drug discovery // Curr. Opin. Drug. Discov. Devel. 2002. V.5. P.690–700. 195.
Burgstaller P., Kochoyan M., Famulok M. Structural probing and damage
selection of citrulline- and arginine-specific RNA aptamers identify base positions required for binding // Nucleic Acids Res. 1995. V.23. P.4769-4776. 196.
Burke D.H., Gold L. RNA aptamers to the adenosine moiety of S-adenosyl
methionine: structural inferences from variations on a theme and the reproducibility of SELEX // Nucleic Acids Res. 1997. V.25. P.2020–2024. 197.
Burke D.H., Hoffman D.C. A novel acidophilic RNA motif that recognizes
coenzyme A // Biochemistry. 1997. V.37. P.4653–4663.
90
198.
Burke D.H., Hoffman D.C., Brown A., Hansen M., Pardi A., Gold L. RNA
aptamers to the peptidyl transferase inhibitor chloramphenicol // Chem. Biol. 1997. V.4. P.833–843. 199.
Burke D.H., Ozerova N.D., Nilsen-Hamilton M. Allosteric hammerhead ribozyme
TRAPs // Biochemistry. 2002. V.41. P.6588–6594. 200.
Burke D.H., Scates L., Andrews K., Gold L. Bent pseudoknots and novel RNA
inhibitors of type 1 human immunodeficiency virus (HIV-1) reverse transcriptase // J. Mol. Biol. 1996. V.264. P.650-666. 201.
Burmeister J., von Kiedrowski G., Ellington A.D. Cofactor-Assisted Self-Cleavage
in DNA Libraries with a 3'-5' Phosphoramidate Bond // Angew. Chem. Int. Ed. Engl. 1997. V.36. P.1321-1324. 202.
Buskirk A.R., Kehayova P.D., Landrigan A., Liu D.R. In vivo evolution of an
RNAbased transcriptional activator // Chem. Biol. 2003. V.10. P.533-540. 203.
Buskirk A.R., Landrigan A., Liu D.R. Engineering a ligand-dependent RNA
transcriptional activator // Chem. Biol. 2004. V.11. P.1157–1163. 204.
Butcher S.E., Burke J.M. Structure-mapping of the hairpin ribozyme. Magnesium-
dependent folding and evidence for tertiary interactions within the ribozyme-substrate complex // J. Mol. Biol. 1994. V.244. P.52–63. 205.
Cadwell R.C., Joyce G.F. Mutagenic PCR // PCR Methods Appl. 1994. V.3.
P.S136-S140. 206.
Cai Z. et al. // Nature Struct. Biol. 1998. V.5. P.203.
207.
Calabro V., Daugherty M.D., Frankel A.D. A single intermolecular contact
mediates intramolecular stabilization of both RNA and protein // PNAS. 2005. V.102. P.6849-6854. 208.
Carmi N., Balkhi S.R., Breaker R.R. Cleaving DNA with DNA // Proc. Natl.
Acad. Sci. USA. 1998. V.95. P.2233-2237. 209.
Carmi N., Shultz L.A., Breaker R.R. In vitro selection of self-cleaving DNAs //
Chem. Biol. 1996. V.3. P.1039-1046. 210.
Carothers J.M., Davis J.H., Chou J.J., Szostak J.W. Solution structure of an
informationally complex high-affinity RNA aptamer to GTP // RNA. 2006. V.12. P.567–579.
91
211.
Carothers J.M., Oestreich S.C., Davis J.H., Szostak J.W. Informational complexity
and functional activity of RNA structures // J. Am. Chem. Soc. 2004. V.126. P.5130– 5137. 212.
Carothers J.M., Oestreich S.C., Szostak J.W. Aptamers selected for higher-affinity
binding are not more specific for the target ligand // J. Am. Chem. Soc. 2006. V.128. P.7929-7937. 213.
Carothers J.M., Szostak J.W. In vitro selection of functional oligonucleotides and
the origins of biochemical activity // S. Klussmann, Ed. Aptamers and synthetic catalytically active oligonucleotides: Identification and applications. Wiley-VCH, Berlin, Germany, 2006. P.3-28. 214.
Cassiday L.A., Maher L.J. In vivo recognition of an RNA aptamer by its
transcription factor target // Biochemistry. 2001. V.40. P.2433–2438. 215.
Cassiday L.A., Maher L.J. Yeast genetic selections to optimize RNA decoys for
transcription factor NF- B // Proc. Natl. Acad. Sci. 2003. V.100. P.3930–3935. 216.
Caughey B., Brown K., Raymond G.J., Katzenstein G.E., Thresher W. Binding of
the protease-sensitive form of PrP (prion protein) to sulfated glycosaminoglycan and congo red // J. Virol. 1994. V.68. P.2135–2141. 217.
Cech T.R. Fostering Innovation and Discovery in Biomedical Research // JAMA.
2005. V.294. P.1390-1393. 218.
Cech T.R. Self-splicing of group I introns // Annu. Rev. Biochem. 1990. V.59.
P.543–568. 219.
Cerchia L., Duconge F., Pestourie C., Boulay J., Aissouni Y., Gombert K.,
Tavitian B., de Franciscis V., Libri D. Neutralizing aptamers from whole-cell SELEX inhibit the RET receptor tyrosine kinase // PLoS Biol. 2005. V.3. P.e123. 220.
Cerchia L., Hamm J., Libri D., Tavitian B., de Franciscis V. Nucleic acid aptamers
in cancer medicine // FEBS Lett. 2002. V.528. P.12-16. 221.
Chapman K.B., Szostak J.W. Isolation of a ribozyme with 5'-5' ligase activity //
Chem. Biol. 1995. V.2. P.325–333. 222.
Chapple K.E., Bartel D.P., Unrau P.J. Combinatorial minimization and secondary
structure determination of a nucleotide synthase ribozyme // RNA. 2003. V.9. P.12081220.
92
223.
Charlton J., Kirschenheuter G.P., Smith D. Highly potent irreversible inhibitors of
neutrophil elastase generated by selection from a randomized DNA-valine phosphonate library // Biochemistry. 1997. V.36. P.3018-3026. 224.
Charlton J., Sennello J., Smith D. In vivo imaging of inflammation using an
aptamer inhibitor of human neutrophil elastase // Chem. Biol. 1997. V.4. P.809–816. 225.
Cheah M.T., Wachter A., Sudarsan N., Breaker R.R. Control of alternative RNA
splicing and gene expression by eukaryotic riboswitches // Nature. 2007. V.447. P.497–500. 226.
Chen C.H., Chernis G.A., Hoang V.Q., Landgraf R. Inhibition of heregulin
signaling by an aptamer that preferentially binds to the oligomeric form of human epidermal growth factor receptor-3 // Proc. Natl. Acad. Sci. USA. 2003. V.100. P.9226-9231. 227.
Chen X., McDowell J.A., Kierzek R., Krugh T.R., Turner D.H. Nuclear magnetic
resonance spectroscopy and molecular modeling reveal that different hydrogen bonding patterns are possible for G·U pairs: One hydrogen bond for each G·U pair in r(GGCGUGCC)(2) and two for each G·U pair in r(GAGUGCUC)(2) // Biochemistry. 2000. V.39. P.8970–8982. 228.
Childs-Disney J.L., Disney M.D. A simple ligation-based method to increase the
information density in sequencing reactions used to deconvolute nucleic acid selections
//
RNA. 2008. V.14. P.390-394. 229.
Chinnapen D.J., Sen D. Hemin-stimulated docking of cytochrome c to a hemin-
DNA aptamer complex // Biochemistry. 2002. V.41. P.5202-5212. 230.
Chinnapen D.J., Sen D. A deoxyribozyme that harnesses light to repair thymine
dimers in DNA // Proc. Natl. Acad. Sci. USA. 2004. V.101. P.65-69. 231.
Chiu Y.L., Ali A., Chu C.Y., Cao H., Rana T.M. Visualizing a correlation between
siRNA localization, cellular uptake, and RNAi in living cells // Chem. Biol. 2004. V.11. P.1165–1175. 232.
Chiu Y.L., Dinesh C.U., Chu C.Y., Ali A., Brown K.M., Cao H., Rana T.M.
Dissecting RNA-interference pathway with small molecules // Chem. Biol. 2005. V.12. P.643–648.
93
233.
Chiu Y.L., Rana T.M. RNAi in human cells. Basic structural and functional
features of small interfering RNA // Mol. Cell. 2002. V.10. P.549–561. 234.
Chiu Y.L., Rana T.M. siRNA function in RNAi: A chemical modification analysis
// RNA. 2003. V.9. P.1034–1048. 235.
Chiuman W., Li Y. Efficient signaling platforms built from a small catalytic DNA
and doubly labeled fluorogenic substrates // Nucleic Acids Res. 2007. V.35. P.401405. 236.
Cho J., Hamasaki K., Rando R.R. The binding site of a specific aminoglycoside
binding RNA molecule // Biochemistry. 1998. V.37. P.4985–4992. 237.
Cho S., Kim J.-E., Lee B.-R., Kim J.-H., Kim B.-G. Bis-aptazyme sensors for
hepatitis C virus replicase and helicase without blank signal // Nucleic Acids Res. 2005. V.33. P.e177-e177. 238.
Choi K.H., Park M.W., Lee S.Y., Jeon M.-Y., Kim M.Y., Lee H.K., Yu J., Kim
H.-J., Han K., Lee H., et al. Intracellular expression of the T-cell factor-1 RNA aptamer as an intramer // Mol. Cancer Ther. 2006. V.5. P.2428-2434. 239.
Chu T.C., Marks J.W. III., Lavery L.A., Faulkner S., Rosenblum M.G., Ellington
A.D., Levy M. Aptamer: Toxin conjugates that specifically target prostate tumor cells // Cancer Res. 2006. V.66. P.5989–5992. 240.
Chu T.C., Twu K.Y., Ellington A.D., Levy M. Aptamer mediated siRNA delivery
// Nucleic Acids Res. 2006. V.34. P.e73. 241.
Chun S.-M., Jeong S., Kim J.-M., Chong B.-O., Park Y.-K., Park K., Yu J.
Cholesterol Esterase Activity by in Vitro Selection of RNA against a Phosphate Transition-State Analogue // J. Am. Chem. Soc. 2006. V.121. P.10844-10845. 242.
Ciesiolka J., Gorski J., Yarus M. Selection of an RNA domain that binds Zn2+ //
RNA. 1995. V.1. P.538-550. 243.
Ciesiolka J., Illangasekare M., Majerfeld I., Nickles T., Welch M., Yarus M.,
Zinnen S. Affinity selection-amplification from randomized ribooligonucleotide pools // Methods Enzymol. 1996. V.267. P.315-335. 244.
Ciesiolka J., Yarus M. Small RNA-divalent domains // RNA. 1996. V.2. P.785-
793.
94
245.
Clark S. L., Remcho V. T. Aptamers as analytical reagents // Electrophoresis.
2002. V.23. P.1335–1340. 246.
Clery A., Bourguignon-Igel V., Allmang C., Krol A., Branlant C. An improved
definition of the RNA-binding specificity of SECIS-binding protein 2, an essential component of the selenocysteine incorporation machinery // Nucleic Acids Res. 2007. V.35. P.1868-1884. 247.
Clouet-d'Orval B., Stage T.K., Uhlenbeck O.C. // Biochemistry. 1995. V.34.
P.11186. 248.
Collett J.R., Cho E.J., Ellington A.D. Production and processing of aptamer
microarrays // Methods. 2005. V.37. P.4–15. 249.
Collin D., van Heijenoort C., Boiziau C., Toulme J.J., Guittet E. NMR
characterization of a kissing complex formed between the TAR RNA element of HIV1 and a DNA aptamer // Nucleic Acids Res. 2000. V.28. P.3386-3391. 250.
Conn M.M., Prudent J.R., Schultz P.G. Porphyrin Metalation Catalyzed by a Small
RNA Molecule // J. Am. Chem. Soc. 1996. V.118. P.7012-7013. 251.
Connell G.J., Illangesekare M., Yarus M. Three small ribooligonucleotides with
specific arginine sites // Biochemistry. 1993. V.32. P.5497-5502. 252.
Connell G.J., Yarus M. RNAs with dual specificity and dual RNAs with similar
specificity // Science. 1994. V.264. P.1137-1141. 253.
Conrad R., Keranen L.M., Ellington A.D., Newton A.C. Isozyme-specific
inhibition of protein kinase C by RNA aptamers // J. Biol. Chem. 1994. V.269. P.32051-32054. 254.
Conrad R.C., Giver L., Tian Y., Ellington A.D. In vitro selection of nucleic acid
aptamers that bind proteins // Methods Enzymol. 1996. V.267. P.336-367. 255.
Convery M.A., Stonehouse N.J., Rowsell S., Ellington A.D., Hirao I., Adams C.J.,
Peabody D.S., Phillips S.E.V., Stockley P.G. Crystal structure of an RNA-aptamer complex at 2.8A resolution. //Nat. Struct. Biol. 1998. V.5. P.133–139. 256.
Coppins R.L., Silverman S.K. A Deoxyribozyme That Forms a Three-Helix-
Junction Complex with Its RNA Substrates and Has General RNA Branch-Forming Activity // J. Am. Chem. Soc. 2005. V.127. P.2900-2907.
95
257.
Cox J.C., Ellington A.D. Automated selection of anti-protein aptamers // Bioorg.
Med. Chem. 2001. V.9. P.2525–2531. 258.
Cox J.C., Hayhurst A., Hesselberth J., Bayer T.S., Georgiou G., Ellington A.D.
Automated selection of aptamers against protein targets translated in vitro: From gene to aptamer // Nucleic Acids Res. 2002. V.30. P.e108. 259.
Cox J.C., Rajendran M., Riedel T., Davidson E.A., Sooter L.J., Bayer T.S.,
Schmitz-Brown M., Ellington A.D. Automated acquisition of aptamer sequences // Comb. Chem. High Throughput Screen. 2002. V.5. P.289-299. 260.
Cox J.C., Rudolph P., Ellington A.D. Automated RNA selection // Biotechnol.
Prog. 1998. V.14. P.845–850. 261.
Crinelli R., Bianchi M., Gentillini L., Magnani M. Design and characterization of
decoy oligonucleotides containing locked nucleic acids // Nucleic Acids Res. 2002. V.30. P.2435–2443. 262.
Cuenoud B., Szostak J.W. A DNA metalloenzyme with DNA ligase activity //
Nature. 1995. V.375. P.611-614. 263.
Cummins L.L., Owens S.R., Risen L.M., Lesnik E.A., Freier S.M., McGee D.,
Guinosso C.J., Cook P.D. Characterization of fully 2'-modified oligonucleotide heteroand homoduplex hybridization and nuclease sensitivity // Nucleic Acids Res. 1995. V.23. P.2019–2024. 264.
Curtis E.A., Bartel D.P. New catalytic structures from an existing ribozyme // Nat.
Struct. Mol. Biol. 2005. V.12. P.994-1000. 265.
Da Rocha Gomes S., Dausse E., Toulme J.J. Determinants of apical loop-internal
loop RNA-RNA interactions involving the HCV IRES // Biochem. Biophys. Res. Commun. 2004. V.322. P.820-826. 266.
Daniels D.A., Chen H., Hicke B.J., Swiderek K.M., Gold L. A tenascin-C aptamer
identified by tumor cell Selex: systematic evolution of ligands by exponential enrichment // Proc. Natl Acad. Sci. USA. 2003. V.100. P.15416–15421. 267.
Daniels D.A., Sohal A.K., Rees S., Grisshammer R. Generation of RNA aptamers
to the G-protein-coupled receptor for neurotensin, NTS-1 // Anal. Biochem. 2002. V.305. P.214-226.
96
268.
Darfeuille F., Hansen J.B., Orum H., Di Primo C., Toulme J.J. LNA/DNA
chimeric oligomers mimic RNA aptamers targeted to the TAR RNA element of HIV-1 // Nucleic Acids Res. 2004. V.32. P.3101–3107. 269.
Das S.R., Piccirilli J.A. General acid catalysis by the hepatitis delta virus ribozyme
// Nat. Chem. Biol. 2005. V.1. P.45-52. 270.
Davidson E.A., Ellington A.D. Engineering regulatory RNAs // Trends
Biotechnol. 2005. V.23. P.109–112. 271.
Davis J.T. G-quartets 40 years later: from 5'-GMP to molecular biology and
supramolecular chemistry // Angew. Chem. Int. Ed. Engl. 2004. V.43. P.668–698. 272.
Davis J.P., Janjic N., Javornik B.E., Zichi D.A. Identifying consensus patterns and
secondary structure in SELEX sequence sets // Methods Enzymol. 1996. V.267. P.302-314. 273.
Davis K.A., Lin Y., Abrams B., Jayasena S.D. Staining of cell surface human CD4
with 2'-F-pyrimidine-containing RNA aptamers for flow cytometry // Nucleic Acids Res. 1998. V.26. P.3915–3924. 274.
Davis J.H., Szostak J.W. Isolation of high-affinity GTP aptamers from partially
structured RNA libraries // Proc. Natl Acad. Sci. USA. 2002. V.99. P.11616–11621. 275.
Degefa T.H., Kwak J. Aptamer Based Electrochemical Detection of Protein Using
Biometallization
//
http://ecsmeet2.peerx-
press.org/ms_files/ecsmeet2/2008/05/29/00002 472/00/ 2472_0_art_0_k1m8fk.pdf. 276.
Dellaire G., Nisman R., Eskiw C.H., Bazett-Jones D.P. In situ imaging and
isolation of proteins using dsDNA oligonucleotides // Nucleic Acids Res. 2004. V.32. P.e165. 277.
Demarre G., Frumerie C., Gopaul D.N., Mazel D. Identification of key structural
determinants of the IntI1 integron integrase that influence attC x attI1 recombination efficiency // Nucleic Acids Res. 2007. V.35. P.6475-6489. 278.
Desai S.K., Gallivan J.P. Genetic screens and selections for small molecules based
on a synthetic riboswitch that activates protein translation // J. Am. Chem. Soc. 2004. V.126. P.13247–13254.
97
279.
de Smidt P.C., Le Doan T., de Falco S., van Berkel T.J. Association of antisense
oligonucleotides with lipoproteins prolongs the plasma half-life and modifies the tissue distribution // Nucleic Acids Res. 1991. V.19. P.4695-4700. 280.
DeStefano J.J., Cristofaro J.V. Selection of primer-template sequences that bind
human immunodeficiency virus reverse transcriptase with high affinity // Nucleic Acids Res. 2006. V.34. P.130-139. 281.
Dey A.K., Griffiths C., Lea S.M., James W. Structural characterization of an
antigp120 RNA aptamer that neutralizes R5 strains of HIV-1 // RNA. 2005. V.11. P.873-884. 282.
Dey A.K., Khati M., Tang M., Wyatt R., Lea S.M., James W. An Aptamer That
Neutralizes R5 Strains of Human Immunodeficiency Virus Type 1 Blocks gp120CCR5 Interaction // J. Virol. 2005. V.79. P.13806-13810. 283.
Dieckmann T., Butcher S.E., Sassanfar M., Szostak J.W., Feigon J. Mutant ATP-
binding RNA aptamers reveal the structural basis for ligand binding // J. Mol. Biol. 1997. V.273. P.467–478. 284.
Dieckmann T., Suzuki E., Nakamura G.K., Feigon J. Solution structure of an ATP-
binding RNA aptamer reveals a novel fold // RNA. 1996. V.2. P.628–640. 285.
Doern C.D., Holder R.C., Reid S.D. Point mutations within the streptococcal
regulator of virulence (Srv) alter protein-DNA interactions and Srv function // Microbiology. 2008. V.154. P.1998-2007. 286.
Doreleijers J.F., Mading S., Maziuk D., Sojourner K., Yin L., Zhu J., Markley J.L.,
Ulrich E.L. BioMagResBank database with sets of experimental NMR constraints corresponding to the structures of over 1400 biomolecules deposited in the Protein Data Bank // J. Biomol. NMR. 2003. V.26. P.139–146. 287.
Dosset P., Hus J.C., Marion D., Blackledge M. A novel interactive tool for rigid-
body modeling of multi-domain macro-molecules using residual dipolar couplings // J. Biomol. NMR. 2001. V.20. P.223–231. 288.
Doudna J.A., Cech T.R., Sullenger B.A. Selection of an RNA molecule that
mimics a major autoantigenic epitope of human insulin receptor // Proc. Natl. Acad. Sci. USA. 1995. V.92. P.2355–2359.
98
289.
Dougan H., Lyster D.M., Vo C.V., Stafford A., Weitz J.I., Hobbs J.B. Extending
the lifetime of anticoagulant oligodeoxynucleotide aptamers in blood // Nucl. Med. Biol. 2000. V.27. P.289-297. 290.
Drabovich A.P., Berezovski M., Okhonin V., Krylov S.N. Selection of smart
aptamers by methods of kinetic capillary electrophoresis // Anal. Chem. 2006. V.78. P.3171-3178. 291.
Drolet D.W., Jenison R.D., Smith D.E., Pratt D., Hicke B.J. A high throughput
platform for systematic evolution of ligands by exponential enrichment (SELEX) // Comb. Chem. High Throughput Screen. 1999. V.2. P.271-278. 292.
Drolet D.W., Moon-McDermott L., Romig T.S. An enzyme-linked oligonucleotide
assay // Nat. Biotechnol. 1996. V.14. P.1021–1025. 293.
Drolet D.W., Nelson J., Tucker C.E., Zack P.M., Nixon K., Bolin R., Judkins
M.B., Farmer J.A., Wolf J.L., Gill S.C., Bendele R.A. Pharmacokinetics and safety of an anti-vascular endothelial growth factor aptamer (NX1838) following injection into the vitreous humor of rhesus monkeys // Pharm. Res. 2000. V.17. P.1503–1510. 294.
Dubey A.K., Baker C.S., Romeo T., Babitzke P. RNA sequence and secondary
structure participate in high-affinity CsrA-RNA interaction // RNA. 2005. V.11. P.1579-1587. 295.
Duconge F., Toulme J.J. In vitro selection identifies key determinants for loop-
loop interactions: RNA aptamers selective for the TAR RNA element of HIV-1 // RNA. 1999. V.5. P.1605-1614. 296.
Duhamel J., Liu D.M., Evilia C., Fleysh N., Dinter-Gottlieb G., Lu P. Secondary
structure content of the HDV ribozyme in 95% formamide // Nucleic Acids Res. 1996. V.24. P.3911–3917. 297.
Eaton B.E., Gold L., Zichi D.A. Let's get specific: the relationship between
specificity and affinity // Chem. Biol. 1995. V.2. P.633–638. 298.
Eder P., DeVine R., Dagle J., Walder J. Substrate specificity and kinetics of
degradation of antisense oligonucleotides by a 3' exonuclease in plasma // Antisense Res. Dev. 1991. V.1. P.141–151.
99
299.
Edwards T.E., Ferreé-D‘Amaré A. Crystal structures of the Thi-box riboswitch
bound to thiamine pyrophosphate analogs reveal adaptive RNA-small molecule recognition // Structure. 2006. V.14. P.1459–1468. 300.
Ehresmann C., Baudin F., Mogel M., Romby P., Ebel J.-P., Ehresmann B. Probing
the structure of RNAs in solution // Nucleic Acids Res. 1987. V.15. P.9109–9128. 301.
Ekland E.H., Bartel D.P. RNA-catalysed RNA polymerization using nucleoside
triphosphates // Nature. 1996. V.382. P.373-376. 302.
Ekland E.H., Szostak J.W., Bartel D.P. Structurally complex and highly active
RNA ligases derived from random RNA sequences // Science. 1995. V.269. P.364370. 303.
Ellingham M., Bunka D.H.J., Rowlands D.J., Stonehouse N.J. Selection and
characterization of RNA aptamers to the RNA-dependent RNA polymerase from footand-mouth disease virus // RNA. 2006. V.12. P.1970 - 1979. 304.
Ellington A.D., Szostak J.W. Selection in vitro of single-stranded DNA molecules
that fold into specific ligand-binding structures // Nature. 1992. V.355. P.850–852. 305.
Elnitski L., Jin V.X., Farnham P.J., Jones S.J.M. Locating mammalian
transcription factor binding sites: A survey of computational and experimental techniques // Genome Res. 2006. V.16. P.1455-1464. 306.
Epshtein V., Mironov A.S., Nudler E. The riboswitch-mediated control of sulfur
metabolism in bacteria // Proc. Natl Acad. Sci. USA. 2003. V.100. P.5052–5056. 307.
Erickson H.P., Bourdon M.A. Tenascin: an extracellular matrix protein prominent
in specialized embryonic tissues and tumors // Annu. Rev. Cell Biol. 1989. V.5. P.71– 92. 308.
Eulberg D., Buchner K., Maasch C., Klussmann S. Development of an automated
in vitro selection protocol to obtain RNA-based aptamers: Identification of a biostable substance P antagonist // Nucleic Acids Res. 2005. V.33. P.e45. 309.
Eulberg D., Klussmann S. Spiegelmers: biostable aptamers // Chembiochem. 2003.
V.4. P.979–983. 310.
Facchini P.J. Alkaloid biosynthesis in plants: Biochemistry, Cell Biology,
Molecular Regulation, and Metabolic Engineering Applications // Annu. Rev. Plant Physiol. Plant Mol. Biol. 2001. V.52. P.29–66.
100
311.
Famulok M. Oligonucleotide aptamers that recognize small molecules // Curr.
Opin. Struct. Biol. 1999. V.9. P.324–329. 312.
Famulok M. Molecular Recognition of Amino Acids by RNA-Aptamers: An
LCitrulline Binding Motif and Its Evolution into an L-Arginine Binder // J. Am. Chem. Soc. 1994. V.116. P.1698-1706. 313.
Famulok M., Blind M., Mayer G. Intramers as promising new tools in functional
proteomics // Chem. Biol. 2001. V.8. P.931-939. 314.
Famulok M., Hüttenhofer A. // Biochemistry. 1996. V.35. P.4265.
315.
Famulok M., Mayer G. Aptamers as tools in molecular biology and immunology //
Curr. Top. Microbiol. Immunol. 1999. V.243. P.123–136. 316.
Famulok M., Szostak J.W. Stereospecific Recognition of Tryptophan Agarose by
in Vitro Selected RNA // J. Am. Chem. Soc. 1992. V.114. P.3990-3991. 317.
9. Famulok M., Verma S. In vivo applied functional RNAs as tools in proteomics
and genomics research // Trends Biotechnol. 2002. V.20. P.462–466. 318.
Fan P., Suri A., Fiala R., Live D., Patel D. Molecular recognition in the FMN-
RNA aptamer complex // J. Mol. Biol. 1996. V.258. P.480–500. 319.
Farokhzad O.C., Cheng J., Teply B.A., Sherifi I., Jon S., Kantoff P.W., Richie J.P.,
Langer R. Targeted nanoparticle-aptamer bioconjugates for cancer chemotherapy in vivo // PNAS. 2006. V.103. P.6315-6320. 320.
Feig A.L., Uhlenbeck O.C. The role of metal ions in RNA biochemistry // R.F.
Gesteland et al., Eds. The RNA world, 2d ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1999. P.287-319. 321.
Faulhammer D., Eschgfäller B., Stark S., Burgstaller P., Englberger W., Erfurth J.,
Kleinjung F., Rupp J., Dan Vulcu S., Schröder W., Vonhoff S., Nawrath H., Gillen C., Klussmann S. Biostable aptamers with antagonistic properties to the neuropeptide nociceptin/orphanin FQ // RNA. 2004. V.10. P.516-527. 322.
Fauzi H., Jack K.D., Hines J.V. In vitro selection to identify determinants in tRNA
for Bacillus subtilis tyrS T box antiterminator mRNA binding // Nucleic Acids Res. 2005. V.33. P.2595-2602. 323.
Feigon J., Dieckmann T., Smith F.W. Aptamer structures from A to zeta // Chem.
Biol. 1996. V.3. P.611–617.
101
324.
Ferguson A., Boomer R.M., Kurz M., Keene S.C., Diener J.L., Keefe A.D.,
Wilson C., Cload S.T. A novel strategy for selection of allosteric ribozymes yields RiboReporterTM sensors for caffeine and aspartame // Nucleic Acids Research. 2004. V.32. P.1756-1766. 325.
Ferré-D‘Amaré A.R., Zhou K., Doudna J.A. Crystal structure of a hepatitis delta
virus ribozyme // Nature. 1998. V.395. P.567–574. 326.
Ferreira C.S., Matthews C.S., Missailidis S. DNA aptamers that bind to MUC1
tumour marker: design and characterization of MUC1-binding single-stranded DNA aptamers // Tumor Biol. 2006. V.27. P.289-301. 327.
Fiammengo R., Jäschke A. Nucleic acid enzymes // Curr. Opin. Biotechnol. 2005.
V.16. P.614–621. 328.
Fiammengo R., Musilek K., Jäschke A. Efficient preparation of organic substrate-
RNA conjugates via in vitro transcription // J. Am. Chem. Soc. 2005. V.127. P.9271– 9276. 329.
Fitzwater T., Polisky B. A SELEX primer // Methods Enzymol. 1996. V.267.
P.275-301. 330.
Flinders J., DeFina S.C., Brackett D.M., Baugh C., Wilson C., Dieckmann T.
Recognition of planar and nonplanar ligands in the malachite green-RNA aptamer complex // ChemBioChem. 2004. V.5. P.62-72. 331.
Flynn-Charlebois A., Lee N., Suga H. A single metal ion plays structural and
chemical roles in an aminoacyl-transferase ribozyme // Biochemistry. 2001. V.40. P.13623-13632. 332.
Flynn-Charlebois A., Prior T.K., Hoadley K.A., Silverman S.K. In Vitro Evolution
of an RNA-Cleaving DNA Enzyme into an RNA Ligase Switches the Selectivity from 3'-5' to 2'-5' // J. Am. Chem. Soc. 2003. V.125. P.5346-5350. 333.
Flynn-Charlebois A., Wang Y., Prior T.K., Rashid I., Hoadley K.A., Coppins R.L.,
Wolf A.C., Silverman S.K. Deoxyribozymes with 2'-5' RNA Ligase Activity // J. Am. Chem. Soc. 2003. V.125. P.2444-2454. 334.
Forster A.C., Symons R.H. Self-cleavage of plus and minus RNAs of a virusoid
and a structural model for the active sites // Cell. 1987. V.49. P.211–220.
102
335.
Fourmy D., Recht M.I., Blanchard S.C., Puglisi J.D. // Science. 1996. V.274.
P.1367. 336.
Fraternali F., Cavallo L. Parameter optimized surfaces (POPS): Analysis of key
interactions and conformational changes in the ribosome // Nucleic Acids Res. 2002. V.30. P.2950–2960. 337.
Frieden M., Christensen S.M., Mikkelsen N.D., Rosenbohm C., Thrue C.A.,
Westergaard M., Hansen H.F., Orum H., Koch T. Expanding the design horizon of antisense oligonucleotides with alpha-L-LNA // Nucleic Acids Res. 2003. V.31. P.6365–6372. 338.
Fuchs R.T., Grundy F.J., Henkin T.M. S-adenosylmethionine directly inhibits
binding of 30S ribosomal subunits to the SMK box translational riboswitch RNA // PNAS. 2007. V.104. P.4876–4880. 339.
Fukuda K., Vishnuvardhan D., Sekiya S., Hwang J., Kakiuchi N., Taira K.,
Shimotohno K., Kumar P.K.R., Nishikawa S. Isolation and characterization of RNA aptamers specific for the hepatitis C virus nonstructural protein 3 protease // Eur. J. Biochem. 2000. V.267. P.3685–3694. 340.
Furlong J.C., Sullivan K.M., Murchie A.I.H., Gough G.W., Lilley D.M.J. //
Biochemistry. 1989. V.28. P.2009–2017. 341.
Fusz S., Eisenfuhr A., Srivatsan S.G., Heckel A., Famulok M. A ribozyme for the
aldol reaction // Chem. Biol. 2005. V.12. P.941-950. 342.
Gan H.H., Pasquali S., Schlick T. Exploring the repertoire of RNA secondary
motifs using graph theory; implications for RNA design // Nucleic Acids Res. 2003. V.31. P.2926-2943. 343.
Guntas G., Mansell T.J., Kim J.R., Ostermeier M. Directed evolution of protein
switches and their application to the creation of ligand-binding proteins // PNAS. 2005. V.102. P.11224-11229. 344.
Garrey S.M., Voelker R., Berglund J.A. An Extended RNA Binding Site for the
Yeast Branch Point-binding Protein and the Role of Its Zinc Knuckle Domains in RNA Binding // J. Biol. Chem. 2006. V.281. P.27443-27453. 345.
Gebhardt K., Shokraei A., Babaie E., Lindqvist B.H. RNA aptamers to S-
adenosylhomocysteine:
kinetic
properties,
103
divalent
cation
dependency,
and
comparison with anti-S-adenosylhomocysteine antibody // Biochemistry. 2000. V.39. P.7255–7265. 346.
Geiger A., Burgstaller P., Eltz H.V., Roeder A., Famulok M. RNA aptamers that
bind
L-arginine
with
sub-micromolar
dissociation
constants
and
high
enantioselectivity // Nucleic Acids Res. 1996. V.24. P.1029–1036. 347.
Gening L.V., Klincheva S.A., Reshetnjak A., Grollman A.P., Miller H. RNA
aptamers selected against DNA polymerase {beta} inhibit the polymerase activities of DNA polymerases beta and kappa // Nucleic Acids Res. 2006. V.34. P.2579-2586. 348.
Gevertz J., Gan H.H., Schlick T. In vitro RNA random pools are not structurally
diverse: A computational analysis // RNA. 2005. V.11. P.853–863. 349.
Geyer C.R., Sen D. Evidence for the metal-cofactor independence of an RNA
phosphodiester-cleaving DNA enzyme // Chem. Biol. 1997. V.4. P.579-593. 350.
Gianneschi N.C., Masar M.S., III, Mirkin C.A. Development of a coordination
chemistry-based approach for functional supramolecular structures // Acc. Chem. Res. 2005. V.38. P.825–837. 351.
Giangrande P.H., Zhang J., Tanner A., Eckhart A.D., Rempel R.E., Andrechek
E.R., Layzer J.M., Keys J.R., Hagen P.-O., Nevins J.R., et al. Distinct roles of E2F proteins in vascular smooth muscle cell proliferation and intimal hyperplasia // PNAS. 2007. V.104. P.12988-12993. 352.
Gietz R.D., Woods R.A. Transformation of yeast by lithium acetate/single-
stranded carrier DNA/polyethylene glycol method // Methods Enzymol. 2002. V.350. P.87–96. 353.
Giver L., Bartel D., Zapp M., Pawul A., Green M., Ellington A.D. Selective
optimization of the Rev-binding element of HIV-1 // Nucleic Acids Res. 1993. V.23. P.5509-5516. 354.
Giver L., Bartel D.P., Zapp M.L., Green M.R., Ellington A.D. Selection and
design of high-affinity RNA ligands for HIV-1 // Rev. Gene. 1993. V.137. P.19-24. 355.
13. Gold L., Polisky B., Uhlenbeck O., Yarus M. Diversity of oligonucleotide
functions // Annu. Rev. Biochem. 1995. V.64. P.763–797. 356.
Golden M.C., Collins B.D., Willis M.C., Koch T.H. Diagnostic potential of
PhotoSELEX-evolved ssDNA aptamers // J. Biotechnol. 2000. V.81. P.167-178.
104
357.
Golden B.L., Gooding A.R., Podell E.R., Cech T.R. A preorganized active site in
the crystal structure of the Tetrahymena ribozyme // Science. 1998. V.282. P.259264. 358.
Gopinath S.C.B., Balasundaresan D., Akitomi J., Mizuno H. An RNA Aptamer
That Discriminates Bovine Factor IX from Human Factor IX // Journal of Biochemistry. 2006. V.140. P.667-676. 359.
Gopinath S.C.B., Misono T., Kawasaki K., Mizuno T., Imai M., Odagiri T.,
Kumar P.K.R. An RNA aptamer that distinguishes between closely related human influenza viruses and inhibits hemagglutinin-mediated membrane fusion // J. Gen. Virol. 2006. V.87. P.479–487. 360.
Gopinath S.C.B., Sakamaki Y., Kawasaki K., Kumar P.K.R. An Efficient RNA
Aptamer against Human Influenza B Virus Hemagglutinin // J. Biochem. 2006. V.139. P.837-846. 361.
Gopinath S.C.B., Shikamoto Y., Mizuno H., Kumar P.K.R. A potent anti-
coagulant RNA aptamer inhibits blood coagulation by blocking specifically an extrinsic clotting pathway // Thromb. Haemost. 2006. V.95. P.767–771. 362.
Göringer H.U., Homann M., Lorger M. In vitro selection of high-affinity nucleic
acid ligands to parasite target molecules // Int. J. Parasitol. 2003. V.33. P.1309–1317. 363.
Göringer H.U., Homann M., Zacharias M., Adler A. RNA aptamers as potential
pharmaceuticals against infections with African trypanosomes // Handb. Exp. Pharmacol. 2006. V.173. P.375–393. 364.
Gossett A.J., Lieb J.D. DNA Immunoprecipitation (DIP) for the Determination of
DNA-Binding Specificity // CSH Protocols 2008, pdb.prot4972. 365.
Grate D., Wilson C. Laser-mediated, site-specific inactivation of RNA transcripts
// Proc. Natl. Acad. Sci. USA. 1999. V.96. P.6131-6136. 366.
Green L., Waugh S., Binkley J.P., Hostomska Z., Hostomsky Z., Tuerk C.
Comprehensive chemical modification interference and nucleotide substitution analysis of an RNA pseudoknot inhibitor to HIV-1 reverse transcriptase // J. Mol. Biol. 1995. V.247. P.60-68.
105
367.
Green L.S., Jellinek D., Bell C., Beebe L.A., Feistner B.D., Gill S.C., Jucker F.M.,
Janjic N. Nuclease-resistant nucleic acid ligands to vascular permeability factor/vascular endothelial growth factor // Chem. Biol. 1995. V.2. P.683–695. 368.
Green L.S., Jellinek D., Jenison R., Ostman A., Heldin C.H., Janjic N. Inhibitory
DNA ligands to platelet-derived growth factor B-chain // Biochemistry. 1996. V.35. P.14413-14424. 369.
Grosshans C.A., Cech T.R. A hammerhead ribozyme allows synthesis of a new
form of the Tetrahymena ribozyme homogeneous in length with a 3' end blocked for transesterification // Nucleic Acids Res. 1991 V.19. P.3875–3880. 370.
Grunweller A., Wyszko E., Bieber B., Jahnel R., Erdmann V.A., Kurreck J.
Comparison of different antisense strategies in mammalian cells using locked nucleic acids, 2'-O-methyl RNA, phosphorothioates and small interfering RNA // Nucleic Acids Res. 2003. V.31. P.3185–3193. 371.
Gugliotti L.A., Feldheim D.L., Eaton B.E. RNA-mediated metal-metal bond
formation in the synthesis of hexagonal palladium nanoparticles // Science. 2004. V.304. P.850-852. 372.
Gugliotti L.A., Feldheim D.L., Eaton B.E. RNA-mediated control of metal
nanoparticle shape // J. Am. Chem. Soc. 2005. V.127. P.17814-17818. 373.
Guo K.-T., Schafer R., Paul A., Gerber A., Ziemer G., Wendel H.P.. A New
Technique for the Isolation and Surface Immobilization of Mesenchymal Stem Cells from Whole Bone Marrow Using High-Specific DNA Aptamers // Stem. Cells. 2006. V.24. P.2220-2231. 374.
Hager A.J., Szostak J.W. Isolation of novel ribozymes that ligate AMP-activated
RNA substrates // Chem. Biol. 1997. V.4. P.607-617. 375.
Hale S.P., Schimmel P. Protein synthesis editing by a DNA aptamer // Proc. Natl.
Acad. Sci. USA. 1996. V.93. P.2755-2758. 376.
Haller A.A., Sarnow P. In vitro selection of a 7-methyl-guanosine binding RNA
that inhibits translation of capped mRNA molecules // Proc. Natl Acad. Sci. USA. 1997. V.94. P.8521–8526.
106
377.
Hamasaki K., Killian J., Cho J., Rando R.R. Minimal RNA constructs that
specifically bind aminoglycoside antibiotics with high affinities // Biochemistry. 1998. V.37. P.656–663. 378.
Hannon G.J., Rossi J.J. Unlocking the potential of the human genome with RNA
interference // Nature. 2004. V.431. P.371–378. 379.
Hansen J.B., Westergaard M., Thrue C.A., Giwercman B., Oerum H. Antisense
knockdown of PKC-alpha using LNA-oligos. Nucleosides Nucleotides // Nucleic Acids. 2003. V.22. P.1607–1609. 380.
Hansen M.R., Mueller L., Pardi A. Tunable alignment of macromolecules by
filamentous phage yields dipolar coupling interactions // Nat. Struct. Biol. 1998. V.5. P.1065–1074. 381.
Hanson S., Bauer G., Fink B., Suess B. Molecular analysis of a synthetic
tetracycline-binding riboswitch // RNA. 2005. V.11. P.503-511. 382.
Hanson S., Berthelot K., Fink B., McCarthy J.E., Suess B. Tetracycline-aptamer-
mediated translational regulation in yeast // Mol. Microbiol. 2003. V.49. P.1627–1637. 383.
Harada K, Frankel A.D. Identification of two novel arginine binding DNAs //
EMBO J. 1995. V.14. P.5798–5811. 384.
Hartig J.S., Grüne I., Najafi-Shoushtari S.H., Famulok M. Sequence-specific
detection of MicroRNAs by signal-amplifying ribozymes // J. Am. Chem. Soc. 2004. V.126. P.722–723. 385.
Hartig J.S., Najifi-Shoushtari S.H., Grune I., Yan A., Ellington A.D., Famulok M.
Protein-dependent ribozymes report molecular interactions in real time // Nat. Biotechnol. 2002. V.20. P.717–722. 386.
Harvey I., Garneau P., Pelletier J. Inhibition of translation by RNA-small molecule
interactions // RNA. 2002. V.8. P.452–463. 387.
Hay B., Barry R.A., Lieberburg I., Prusiner S.B., Lingappa V.R. Biogenesis and
transmembrane orientation of the cellular isoform of the scrapie prion protein // Mol. Cell Biol. 1987. V.2. P.914–920. 388.
Heim R., Tsien R.Y. Engineering green fluorescent protein for improved
brightness longer // Curr. Biol. 1996. V.6. P.178-182.
107
389.
Held D.M., Greathouse S.T., Agrawal A., Burke D.H. Evolutionary landscapes for
the acquisition of new ligand recognition by RNA aptamers // J. Mol. Evol. 2003. V.57. P.299-308. 390.
Helm M., Petermeier M., Ge B., Fiammengo R., Jäschke A. Allosterically
activated Diels-Alder catalysis by a ribozyme // J. Am. Chem. Soc. 2005. V.127. P.10492–10493. 391.
Helmling S., Maasch C., Eulberg D., Buchner K., Schroder W., Lange C., Vonhoff
S., Wlotzka B., Tschop M.H., Rosewicz S., Klussmann S. Inhibition of ghrelin action in vitro and in vivo by an RNA-Spiegelmer // Proc. Natl. Acad. Sci. USA. 2004. V.101. P.13174-13179. 392.
Hermann T. Chemical and functional diversity of small molecule ligands for RNA
// Biopolymers. 2003. V.70. P.4-18. 393.
Hermann T., Patel D.J. // J. Mol. Biol. 1999. V.294. P.825.
394.
10. Hermann T., Patel D.J. Biochemistry—Adaptive recognition by nucleic acid
aptamers // Science. 2000. V.287. P.820–825. 395.
Hermann T., Westhof E. // J. Med. Chem. 1999. V.42. P.1250.
396.
Hermann T., Westhof E. // Biopolymers: Nucleic Acid Sci. 1998. V.48. P.155.
397.
Hermann T., Westhof E. // J. Mol. Biol. 1998. V.276. P.903.
398.
^Hermann T., Westhof E. // Chem. Biol. 1999. V.6. P.R335.
399.
Hertel K.J., Herschlag D., Uhlenbeck O.C. A kinetic and thermodynamic
framework for the hammerhead ribozyme reaction // Biochemistry. 1994. V.33. P.3374–3385. 400.
Hesselberth J.R., Miller D., Robertus J., Ellington A.D. In vitro selection of RNA
molecules that inhibit the activity of ricin A-chain // J. Biol. Chem. 2000. V.275. P.4937–4942. 401.
Hesselberth J.R., Robertson M.P., Knudsen S.M., Ellington A.D. Simultaneous
detection of diverse analytes with an aptazyme ligase array // Anal. Biochem. 2003. V.312. P.106–112. 402.
Heus H.A., Pardi A. // Science. 1991. V.253. P.191.
108
403.
Hicke B.J., Marion C., Chang Y.-F., Gould T., Lynott C.K., Parma D., Schmidt
P.G., Warren S. Tenascin-C aptamers are generated using tumor cells and purified protein // J. Biol. Chem. 2001. V.276. P.48644–48654. 404.
Hicke B.J., Stephens A.W. Escort aptamers: a delivery service for diagnosis and
therapy // J. Clin. Invest. 2000. V.106. P.923–928. 405.
Hicke B.J., Watson S.R., Koenig A., Lynott C.K., Bargatze R.F., Chang Y.F.,
Ringquist S., Moon-McDermott L., Jennings S., Fitzwater T., Han H.L., Varki N., Albinana I., Willis M.C., Varki A., Parma D. DNA aptamers block L-selectin function in vivo. Inhibition of human lymphocyte trafficking in SCID mice // J. Clin. Invest. 1996. V.98. P.2688-2692. 406.
Hilger S., Willis M.C., Wolters M., Pieken W.A. Tc-99m-labeling of modified
RNA // Nucleosides Nucleotides. 1999. V.18. P.1479–1481. 407.
Hilger S., Willis M.C., Wolters M., Pieken W.A. Synthesis of Tc-99m labelled,
modified RNA // Tetrahedron Lett. 1998. V.39. P.9403–9406. 408.
Hilger C.S., Willis M.C., Wolters M., Pieken W.A. Tc-99m labeling of modified
RNA // Nicolini M. and Mazzi U., Eds. Technetium, Rhenium and Other Metals in Chemistry and Nuclear Medicine. SG Editoriali, Padova, V.5, 1999. P.557–560. 409.
Hirao I., Harada Y., Nojima T., Osawa Y., Masaki H., Yokoyama S. In vitro
selection of RNA aptamers that bind to colicin E3 and structurally resemble the decoding site of 16S ribosomal RNA // Biochemistry. 2004. V.43. P.3214-3221. 410.
Hirao I., Madin K., Endo Y., Yokoyama S., Ellington A.D. RNA aptamers that
bind to and inhibit the ribosome-inactivating protein, pepocin // J. Biol. Chem. 2000. V.275. P.4943-4948. 411.
Hirao I., Spingola M., Peabody D., Ellington A.D. The limits of specificity: An
experimental analysis with RNA aptamers to MS2 coat protein variants // Mol. Divers. 1998. V.4. P.75–89. 412.
Hoadley K.A., Purtha W.E., Wolf A.C., Flynn-Charlebois A., Silverman S.K.
Zn2+-Dependent Deoxyribozymes That Form Natural and Unnatural RNA Linkages // Biochemistry. 2005. V.44. P.9217-9231. 413.
Hodgson D.R., Suga H. Mechanistic studies on acyl-transferase ribozymes and
beyond // Biopolymers. 2004. V.73. P.130–150.
109
414.
Hoffmann B., Mitchell G.T., Gendron P., Major F., Andersen A.A., Collins R.A.,
Legault P. NMR structure of the active conformation of the Varkud satellite ribozyme cleavage site // Proc. Natl. Acad. Sci. 2003. V.100. P.7003–7008. 415.
Hofmann H.P., Limmer S., Hornung V., Sprinzl M. Ni2+-binding RNA motifs
with an asymmetric purine-rich internal loop and a G-A base pair // RNA. 1997. V.3. P.1289-1300. 416.
Holeman L.A., Robinson S.L., Szostak J.W., Wilson C. Isolation and
characterization of fluorophore-binding RNA aptamers // Fold. Des. 1998. V.3. P.423431. 417.
Homann M., Göringer H.U. Combinatorial selection of high affinity RNA ligands
to live African trypanosomes // Nucleic Acids Res. 1999. V.27. P.2006–2014. 418.
Homann M., Lorger M., Engstler M., Zacharias M., Göringer H.U. Serum-stable
RNA aptamers to an invariant surface domain of live African trypanosomes // Comb. Chem. High Throughput Screen. 2006. V.9. P.491–499. 419.
Hoogstraten C.G., Legault P., Pardi A. NMR solution structure of the lead-
dependent ribozyme: evidence for dynamics in RNA catalysis // J. Mol. Biol. 1998. V.284. P.337-350. 420.
Hook B., Bernstein D., Zhang B., Wickens M. RNA–protein interactions in the
yeast three-hybrid system: Affinity, sensitivity, and enhanced library screening // RNA. 2005. V.11. P.227–233. 421.
Hormes R., Sczakiel G. The size of hammerhead ribozymes is related to cleavage
kinetics: the role of substrate length // Biochimie. 2002. V.84. P.897–903. 422.
Horn W.T., Convery M.A., Stonehouse N.J., Adams C.J., Liljas L., Phillips S.E.,
Stockley P.G. The crystal structure of a high affinity RNA stem-loop complexed with the bacteriophage MS2 capsid: further challenges in the modeling of ligand-RNA interactions // RNA. 2004. V.10. P.1776-1782. 423.
Hornung V., Hofmann H.P., Sprinzl M. In vitro selected RNA molecules that bind
to elongation factor Tu // Biochemistry. 1998. V.37. P.7260–7267. 424.
Hoshika S., Minakawa N., Matsuda A. Synthesis and physical and physiological
properties of 4'-thioRNA: application to post-modification of RNA aptamer toward NF-{kappa}B // Nucleic Acids Res. 2004. V.32. P.3815-3825.
110
425.
Howard E.L., Becker K.C.D., Rusconi C.P., Becker R.C. Factor IXa Inhibitors as
Novel Anticoagulants // Arterioscler. Thromb. Vasc. Biol. 2007. V.27. P.722-727. 426.
Hsiung C., Patel D.J. // Nat. Struct. Biol. 1996. V.3. P.1046–1050.
427.
Huang F., Bugg C.W., Yarus M. RNA-Catalyzed CoA, NAD, and FAD synthesis
from phosphopantetheine, NMN, and FMN // Biochemistry. 2000. V.39. P.1554815555. 428.
Huang F., Yang Z., Yarus M. RNA enzymes with two small-molecule substrates //
Chem. Biol. 1998. V.5. P.669–678. 429.
Huang F., Yarus M. 5'-RNA self-capping from guanosine diphosphate //
Biochemistry. 1997. V.36. P.6557-6563. 430.
Huang Z., Szostak J.W. Evolution of aptamers with a new specificity and new
secondary structures from an ATP aptamer // RNA. 2003. V.9. P.1456-1463. 431.
Huizenga D.E., Szostak J.W. A DNA aptamer that binds adenosine and ATP //
Biochemistry. 1995. V.34. P.656–665. 432.
Hwang B., Cho J.S., Yeo H.J., Kim J.H., Chung K.M., Han K., Jang S.K., Lee
S.W. Isolation of specific and high-affinity RNA aptamers against NS3 helicase domain of hepatitis C virus // RNA. 2004. V.10. P.1277–1290. 433.
Hwang B., Lee S.W. Improvement of RNA aptamer activity against myasthenic
autoantibodies by extended sequence selection // Biochem. Biophys. Res. Commun. 2002. V.290. P.656-662. 434.
Hwang J., Fauzi H., Fukuda K., Sekiya S., Kakiuchi N., Shimotohno K., Taira K.,
Kusakabe I., Nishikawa S. The RNA aptamer-binding site of hepatitis C virus NS3 protease // Biochem. Biophys. Res. Commun. 2000. V.279. P.557–562. 435.
Hwang J., Nishikawa S. Novel Approach to Analyzing RNA Aptamer-Protein
Interactions: Toward Further Applications of Aptamers // J. Biomol. Screen. 2006. V.11. P.599-605. 436.
Hybarger G., Bynum J., Williams R.F., Valdes J.J., Chambers J.P. A microfluidic
SELEX prototype // Anal. Bioanal. Chem. 2006. V.384. P.191-198. 437.
Jagannathan V., Roulet E., Delorenzi M., Bucher P. HTPSELEX--a database of
high-throughput SELEX libraries for transcription factor binding sites // Nucleic Acids Res. 2006. V.34. P.D90-D94.
111
438.
James W. Aptamers in the virologists' toolkit // J. Gen. Virol. 2007. V.88. P.351-
364. 439.
Jarosch F., Buchner K., Klussmann S. In vitro selection using a dual RNA library
that allows primerless selection // Nucleic Acids Res. 2006. V.34. P.e86. 440.
4. Jäschke A. Artificial ribozymes and deoxyribozymes // Curr. Opin. Struct. Biol.
2001. V.11. P.321–326. 441.
Jaschke A., Seelig B. Evolution of DNA and RNA as catalysts for chemical
reactions // Curr. Opin. Struct. Biol. 2000. V.4. P.257–262. 442.
Jayasena S.D. Aptamers: an emerging class of molecules that rival antibodies in
diagnostics // Clin. Chem. 1999. V.45. P.1628–1650. 443.
Jayasena V.K., Gold L. In vitro selection of self-cleaving RNAs with a low pH
optimum // Proc. Natl. Acad. Sci. USA. 1997. V.94. P.10612-10617. 444.
Jellinek D., Green L.S., Bell C., Janjic N. Inhibition of receptor-binding by high-
affinity RNA ligands to vascular endothelial growth-factor // Biochemistry. 1994. V.33. P.10450–10456. 445.
Jellinek D., Green L.S., Bell C., Lynott C.K., Gill N., Vargeese C., Kirschenreuter
G., McGee D.P., Abesinghe P., Pieken W.A., Shapiro R., Rifkin D.B., Moscatelli D., Janjic N. Potent 2'-amino-2'-deoxypyrimidine RNA inhibitors of basic fibroblast growth factor // Biochemistry. 1995. V.34. P.11363–11372. 446.
Jenison R.D., Gill S.C., Pardi A., Polisky B. High-resolution molecular
discrimination by RNA // Science. 1994. V.263. P.1425–1429. 447.
Jenison R.D., Jennings S.D., Walker D.W., Bargatze R.F., Parma D.
Oligonucleotide inhibitors of P-selectin-dependent neutrophil-platelet adhesion // Antisense Nucleic Acid Drug Dev. 1998. V.8. P.265-279. 448.
Jenne A., Famulok M. A novel ribozyme with ester transferase activity // Chem.
Biol. 1998. V.5. P.23-34. 449.
Jensen K.B., Atkinson B.L., Willis M.C., Koch T.H., Gold L. Using in vitro
selection to direct the covalent attachment of human immunodeficiency virus type 1 Rev protein to high-affinity RNA ligands // Proc. Natl. Acad. Sci. USA. 1995. V.92. P.12220-12224.
112
450.
Jeon S. H., Kayhan B., Ben-Yedidia T., Arnon R. A DNA aptamer prevents
influenza infection by blocking the receptor binding region of the viral hemagglutinin // J. Biol. Chem. 2004. V.279. P.48410–48419. 451.
Jeong S., Eom T., Kim S., Lee S., Yu J. In vitro selection of the RNA aptamer
against the Sialyl Lewis X and its inhibition of the cell adhesion // Biochem. Biophys. Res. Commun. 2001. V.281. P.237–243. 452.
Jepsen J.S., Wengel J. LNA-antisense rivals siRNA for gene silencing // Curr.
Opin. Drug Discov. Devel. 2004. V.7. P.188–194. 453.
Jhaveri S., Rajendran M., Ellington A.D. In vitro selection of signaling aptamers //
Nat. Biotechnol. 2000. V.18. P.1293–1297. 454.
Jiang F., Kumar R.A., Jones R.A., Patel D.J. Structural basis of RNA folding and
recognition in an AMP–RNA aptamer complex // Nature. 1996. V.382. P.183–186. 455.
Jiang F., et al. // Structure Fold. Des. 1991. V.7. P.1461.
456.
Jiang L.C., Majumdar A., Hu W.D., Jaishree T.J., Xu W.K., Patel D.J. Saccharide-
RNA recognition in a complex formed between neomycin B and an RNA aptamer // Structure Fold. Des. 1999. V.7. P.817–827. 457.
Jiang L., Patel D.J. Solution structure of the tobramycin-RNA aptamer complex //
Nature Struct. Biol. 1998. V.5. P.769–774. 458.
Jiang L., Suri A.K., Fiala R., Patel D.J. Saccharide-RNA recognition in an
aminoglycoside antibiotic-RNA aptamer complex // Chem. Biol. 1997. V.4. P.35. 459.
Jiang Y., Wang J., Fang X., Bai C. Study of the effect of metal ion on the specific
interaction between protein and aptamer by atomic force microscopy // J. Nanosci. Nanotechnol. 2004. V.4. P.611–615. 460.
Jiang Y., Zhu C., Ling L., Wan L., Fang X., Bai C. Specific aptamer-protein
interaction studied by atomic force microscopy // Anal. Chem. 2003. V.75. P.21122116. 461.
Johns G.C., Joyce G.F. The promise and peril of continuous in vitro evolution // J.
Mol. Evol. 2005. V.61. P.253-263. 462.
Johnson S.C., Sherrill C.B., Marshall D.J., Moser M.J., Prudent J.R. A third base
pair for the polymerase chain reaction: inserting isoC and isoG // Nucleic Acids Res. 2004. V.32. P.1937-1941.
113
463.
Johnston W.K., Unrau P.J., Lawrence M.S., Glasner M.E., Bartel D.P.
RNACatalyzed RNA Polymerization: Accurate and General RNA-Templated Primer Extension // Science. 2001. V.292. P.1319-1325. 464.
Jose A.M., Soukup G.A., Breaker R.R. Cooperative binding of effectors by an
allosteric ribozyme // Nucleic Acids Res. 2001. V.29. P.1631-1637. 465.
Joyce G.F. Directed Evolution of Nucleic Acid Enzymes // Annu. Rev. Biochem.
2004. V.73. P.791-836. 466.
12. Joyce G.F. // Curr. Opin. Struct. Biol. 1994. V.4. P.331.
467.
Jucker F.M., Phillips R.M., McCallum S.A., Pardi A. Role of a heterogeneous free
state in the formation of a specific RNA-theophylline complex // Biochemistry. 2003. V.42. P.2560-2567. 468.
Juliano R.L., Astriab-Fisher A., Falke D. Macromolecular Therapeutics: Emerging
Strategies for Drug Discovery in the Postgenome Era // Mol. Interv. 2001. V.1. P.4053. 469.
Ikebukuro K., Okumura Y., Sumikura K., Karube I. A novel method of screening
thrombin-inhibiting DNA aptamers using an evolution-mimicking algorithm // Nucleic Acids Res. 2005. V.33. P.e108. 470.
Illangasekare M., Sanchez G., Nickles T., Yarus M. Aminoacyl-RNA synthesis
catalyzed by an RNA // Science. 1995. V.267. P.643–647. 471.
Illangasekare M., Yarus M. Specific, rapid synthesis of Phe-RNA by RNA // Proc.
Natl. Acad. Sci. USA. 1999. V.96. P.5470-5475. 472.
Illangasekare M., Yarus M. A tiny RNA that catalyzes both aminoacyl-RNA and
peptidyl-RNA synthesis // RNA. 1999. V.5. P.1482-1489. 473.
Ireson C.R., Kelland L.R. Discovery and development of anticancer aptamers //
Mol. Cancer Ther. 2006. V.5. P.2957-2962. 474.
Isaacs F.J., Dwyer D.J., Collins J.J. // Nat. Biotechnol. 2006. V.24. P.545–554.
475.
Isaacs F.J., Dwyer D.J., Ding C., Pervouchine D.D., Cantor C.R., Collins J.J.
Engineered riboregulators enable post-transcriptional control of gene expression // Nat. Biotechnol. 2004. V.22. P.841–847. 476.
Iyo M., Kawasaki H., Taira K. Allosterically controllable maxizymes for
molecular gene therapy // Curr. Opin. Mol. Ther. 2002. V.4. P.154–165.
114
477.
Iyo M., Kawasaki H., Taira K. Maxizyme technology // Methods Mol. Biol. 2004.
V.252. P.257–265. 478.
Kang Y., Bogerd H.P., Yang J., Cullen B.R. Analysis of the RNA binding
specificity of the human Tap protein, a constitutive transport element-specific nuclear RNA export factor // Virology. 1999. V.262. P.200–209. 479.
Katilius E., Flores C., Woodbury N.W. Exploring the sequence space of a DNA
aptamer using microarrays // Nucleic Acids Res. 2007. V.35. P.7626-7635. 480.
Kato T., Takemura T., Yano K., Ikebukuro K., Karube I. In vitro selection of DNA
aptamers which bind to cholic acid. Biochim // Biochim. Biophys. Acta. 2000. V.1493. P.12-18. 481.
Kato T., Yano K., Ikebukuro K., Karube I. Interaction of three-way DNA
junctions with steroids // Nucleic Acids Research. 2000. V.28. P.1963-1968. 482.
Kato Y., Minakawa N., Komatsu Y., Kamiya H., Ogawa N., Harashima H.,
Matsuda A. New NTP analogs: the synthesis of 4'-thioUTP and 4'-thioCTP and their utility for SELEX // Nucleic Acids Res. 2005. V.33. P.2942-2951. 483.
Kawakami J., Imanaka H., Yokota Y., Sugimoto N. In vitro selection of aptamers
that act with Zn2+ // J. Inorg. Biochem. 2000. V.82. P.197-206. 484.
Keiper S., Vyle J.S. Reversible photocontrol of deoxyribozyme-catalyzed RNA
cleavage under multiple-turnover conditions // Angew. Chem. Int. Ed. 2006. V.45. P.3306-3309. 485.
Kelly J.A., Feigon J., Yeates T.O. Reconciliation of the X-ray and NMR structures
of the thrombin-binding aptamer d(GGTTGGTGTGGTTGG) // J. Mol. Biol. 1996. V.256. P.417-422. 486.
Kertsburg A., Soukup G.A. A versatile communication module for controlling
RNA folding and catalysis // Nucleic Acids Res. 2002. V.30. P.4599-4606. 487.
Khati M., Schuman M., Ibrahim J., Sattentau Q., Gordon S., James W.
Neutralization
of
infectivity
of
diverse
R5
clinical
isolates
of
human
immunodeficiency virus type 1 by gp120-binding 2'F-RNA aptamers // J. Virol. 2003. V.77. P.12692-12698. 488.
Kheradpour P., Stark A., Roy S., Kellis M. Reliable prediction of regulator targets
using 12 Drosophila genomes // Genome Res. 2007. V.17. P.1919-1931.
115
489.
Khvorova A., Lescoute A., Westhof E., Jayasena S.D. // Nat. Struct. Biol. 2003.
V.10. P.708–712. 490.
Kiga D., Futamura Y., Sakamoto K., Yokoyama S. An RNA aptamer to the
xanthine/guanine base with a distinctive mode of purine recognition // Nucleic Acids Res. 1998. V.26. P.1755–1760. 491.
Kikuchi K., Umehara T., Fukuda K., Hwang J., Kuno A., Hasegawa T., Nishikawa
S. RNA aptamers targeted to domain II of hepatitis C virus IRES that bind to its apical loop region // J. Biochem. 2003. V.133. P.263–270. 492.
Kikuchi K., Umehara T., Fukuda K., Kuno A., Hasegawa T., Nishikawa S. A
hepatitis C virus (HCV) internal ribosome entry site (IRES) domain III-IV-targeted aptamer inhibits translation by binding to an apical loop of domain IIId // Nucleic Acids Res. 2005. V.33. P.683-692. 493.
Kim Y., Cao Z., Tan W. Molecular assembly for high-performance bivalent
nucleic acid inhibitor // PNAS. 2008. V.105. P. 5664-5669. 494.
Kim Y.M., Choi K.H., Jang Y.J., Yu J., Jeong S. Specific modulation of the anti-
DNA autoantibody-nucleic acids interaction by the high affinity RNA aptamer // Biochem. Biophys. Res. Commun. 2003. V.300. P.516-523. 495.
Kim N., Gan H.H., Schlick T. A computational proposal for designing structured
RNA pools for in vitro selection of RNAs // RNA. 2007. V.13. P.478-492. 496.
Kim D.S., Gusti V., Pillai S.G., Gaur R.K. An artificial riboswitch for controlling
pre-mRNA splicing // RNA. 2005. V.11. P.1667–1677. 497.
Kim M.Y., Jeong S. Inhibition of the functions of the nucleocapsid protein of
human immunodeficiency virus-1 by an RNA aptamer // Biochem. Biophys. Res. Commun. 2004. V.320. P.1181-1186. 498.
Kim S.J., Kim M.Y., Lee J.H., You J.C., Jeong S. Selection and stabilization of the
RNA aptamers against the human immunodeficiency virus type-1 nucleocapsid protein // Biochem. Biophys. Res. Commun. 2002. V.291. P.925–931. 499.
Kim J.S., Park S.J., Kwak K.J., Kim Y.O., Kim J.Y., Song J., Jang B., Jung C.-H.,
Kang H. Cold shock domain proteins and glycine-rich RNA-binding proteins from Arabidopsis thaliana can promote the cold adaptation process in Escherichia coli // Nucleic Acids Res. 2007. V.35. P.506-516.
116
500.
Kim J.N., Roth A., Breaker R.R. Guanine riboswitch variants from Mesoplasma
florum selectively recognize 2‘-deoxyguanosine // PNAS. 2007. V.104. P.16092– 16097. 501.
Kim E.S., Serur A., Huang J., Manley C.A., McCrudden K.W., Frischer J.S.,
Soffer S.Z., Ring L., New T., Zabski S., Rudge J.S., Holash J., Yancopoulos G.D., Kandel J.J., Yamashiro D.J. Potent VEGF blockade causes regression of coopted vessels in a model of neuroblastoma // Proc. Natl. Acad. Sci. USA. 2002. V.99. P.11399-11404. 502.
Kimata Y., Iwaki M., Lim C.R., Kohno K. A novel mutation which enhances the
fluorescence of green fluorescent protein at high temperatures // Biochem. Biophys. Res. Commun. 1997. V.232. P.69-73. 503.
Kim-Ha J., Kerr K., MacDonald P.M. Translational regulation of oskar mRNA by
bruno, an ovarian RNA-binding protein, is essential // Cell. 1995. V.81. P.403–412. 504.
Kimoto M., Shirouzu M., Mizutani S., Koide H., Kaziro Y., Hirao I., Yokoyama S.
Anti-(Raf-1) RNA aptamers that inhibit Ras-induced Raf-1 activation // Eur. J. Biochem. 2002. V.269. P.697-704. 505.
Kitamura A., Muto Y., Watanabe S., Kim I., Ito T., Nishiya Y., Sakamoto K.,
Ohtsuki T., Kawai G., Watanabe K., et al. Solution structure of an RNA fragment with the P7/P9.0 region and the 3%-terminal guanosine of the tetrahymena group I intron // RNA. 2002. V.8. P.440–451. 506.
Kleinjung F., Klussmann S., Erdmann V.A., Scheller F.W., Furste J.P., Bier F.F.
High-affinity RNA as a recognition element in a biosensor // Anal. Chem. 1998. V.70. P.328–331. 507.
Klug S.J., Huttenhofer A., Famulok M. In vitro selection of RNA aptamers that
bind special elongation factor SelB, a protein with multiple RNA-binding sites, reveals one major interaction domain at the carboxyl terminus // RNA. 1999. V.5. P.1180-1190. 508.
Klug S.J., Huttenhofer A., Kromayer M., Famulok M. In vitro and in vivo
characterization of novel mRNA motifs that bind special elongation factor SelB // Proc. Natl. Acad. Sci. USA. 1997. V.94. P.6676-6681.
117
509.
Klussmann S., Nolte A., Bald R., Erdmann V.A., Fuerste J.P. Mirror-image RNA
that binds D-adenosine // Nat. Biotechnol. 1996. V.14. P.1112–1115. 510.
Kneller D.G., Kuntz I.D. UCSF Sparky: An NMR display, annotation and
assignment tool // J. Cell. Biochem. 1993. V.53. P.254. 511.
Knight R., Birmingham A., Yarus M. BayesFold: Rational 2° folds that combine
thermodynamic, covariation, and chemical data for aligned RNA sequences // RNA. 2004. V.10. P.1323–1336. 512.
Knight R., De Sterck H., Markel R., Smit S., Oshmyansky A., Yarus M.
Abundance of correctly folded RNA motifs in sequence space, calculated on computational grids // Nucleic Acids Res. 2005. V.33. P.5924-5935. 513.
Knight R., Yarus M. Analyzing partially randomized nucleic acid pools: straight
dope on doping // Nucleic Acids Res. 2003. V.31. P.e30. 514.
Knight R., Yarus M. Finding specific RNA motifs: function in a zeptomole world?
// RNA. 2003. V.9. P.218-230. 515.
Knosp W.M., Saneyoshi C., Shou S., Bachinger H.P., Stadler H.S. Elucidation,
Quantitative Refinement, and in Vivo Utilization of the HOXA13 DNA Binding Site // J. Biol. Chem. 2007. V.282. P.6843-6853. 516.
Knudsen S.M., Ellington A.D. // Klussmann S., Ed. The Aptamer Handbook.
Wiley-VCH, Weinheim, 2006. P.290–310. 517.
Kobasa D., Takada A., Shinya K., et al. Enhanced virulence of influenza A viruses
with the haemagglutinin of the 1918 pandemic virus // Nature. 2004. V.431. P.703– 707. 518.
Kobelt P., Helmling S., Stengel A., Wlotzka B., Andresen V., Klapp B.F.,
Wiedenmann B., Klussmann S., Monnikes H. Anti-ghrelin Spiegelmer NOX-B11 inhibits neurostimulatory and orexigenic effects of peripheral ghrelin in rats // Gut. 2006. V.55. P.788-792. 519.
Koizumi M., Breaker R.R. Molecular recognition of cAMP by an RNA aptamer //
Biochemistry. 2000. V.39. P.8983–8992. 520.
Koizumi M., Soukup G.A., Kerr J.N., Breaker R.R. Allosteric selection of
ribozymes that respond to the second messengers cGMP and cAMP // Nature Struct. Biol. 1999. V.6. P.1062–1071.
118
521.
Komatsu Y., Yamashita S., Kazama N., Nobuoka K., Ohtsuka E. Construction of
new ribozymes requiring short regulator oligonucleotides as a cofactor // J. Mol. Biol. 2000. V.299. P.1231-1243. 522.
Konig J., Julius C., Baumann S., Homann M., Goringer H.U., Feldbrugge M.
Combining SELEX and the yeast three-hybrid system for in vivo selection and classification of RNA aptamers // RNA. 2007. V.13. P.614-622. 523.
Kore A.R., Vaish N.K., Morris J.A., Eckstein F. In vitro evolution of the
hammerhead ribozyme to a purine-specific ribozyme using mutagenic PCR with two nucleotide analogues // J. Mol. Biol. 2000. V.301. P.1113-1121. 524.
Korth C., Stierli B., Streit P., Moser M., Schaller O., Fischer R., Schulz-Schaeffer
W., Kretzschmar H., Raeber A., Braun U., Ehrensperger F., Hornemann S., Glockshuber R., Riek R., Billeter M., Wuthrich K., Oesch B. Prion (PrP Sc)-specific epitope defined by a monoclonal antibody // Nature. 1997. V.390. P.74–77. 525.
Koshkin A.A., Nielsen P., Meldgaard M., Rajwanshi V.K., Singh S.K., Wengel J.
LNA (Locked Nucleic Acid): an RNA mimic forming exceedingly stable LNA:LNA duplexes // J. Am. Chem. Soc. 1998. V.120. P.13252–13253. 526.
Koshkin A.A., Rajwanshi V.K., Wengel J. Novel convenient synthesis of LNA
[2.2.1] bicyclo nucleosides // Tetrahedron Lett. 1998. V.39. P.4381–4384. 527.
Koshkin A.A., Singh S.K., Nielsen P., Rajwanshi V.K., Kumar R., Meldgaard M.,
Olsen C.E., Wengel J. LNA (Locked Nucleic Acids) synthesis of the Adenine, Cytosine, Guanine, 5-Methylcytosine, Thymine and Uracil bicyclonucleoside monomers, oligomerisation, and unprecedented nucleic acid recognition
//
Tetrahedron. 1998. V.54. P.3607–3630. 528.
Kovbasyuk L., Krämer R. Allosteric supramolecular receptors and catalysts //
Chem. Rev. 2004. V.104. P.3161–3187. 529.
Krylov S.N. Nonequilibrium Capillary Electrophoresis of Equilibrium Mixtures
(NECEEM): A Novel Method for Biomolecular Screening // J. Biomol. Screen. 2006. V.11. P.115-122. 530.
Kubik M.F., Bell C., Fitzwater T., Watson S.R., Tasset D.M. Isolation and
characterization of 2'-fluoro-, 2'-amino-, and 2'-fluoro-/amino-modified RNA ligands
119
to human IFN-gamma that inhibit receptor binding // J. Immunol. 1997. V.159. P.259267. 531.
Kubodera T., Watanabe M., Yoshiuchi K., Yamashita N., Nishimura A., Nakai S.,
Gomi K., Hanamoto H. Thiamine-regulated gene expression of Aspergillus oryzae thiA requires splicing of the introns containing a riboswitch-like domain in the 5'-UTR // FEBS Lett. 2003. V.555. P.516–520. 532.
Kühnast B., Dollé F., Terrazzino S., Rousseau B., Loch C., Vaufrey F., Hinnen F.,
Doignon I., Pillon F., David C., Crouzel C., Tavitian B. General method to label antisense oligonucleotides with radioactive halogens for pharmacological and imaging studies // Bioconjug. Chem. 2000. V.11. P.627–636. 533.
Kulkarni O., Pawar R.D., Purschke W., Eulberg D., Selve N., Buchner K.,
Ninichuk V., Segerer S., Vielhauer V., Klussmann S., et al. Spiegelmer Inhibition of CCL2/MCP-1 Ameliorates Lupus Nephritis in MRL-(Fas)lpr Mice // J. Am. Soc. Nephrol. 2007. V.18. P.2350-2358. 534.
Kumar P.K.R., Machida K., Urvil P.T., Kakiuchi N., Vishnuvardhan D.,
Shimotohno K., Taira K., Nishikawa S. Isolation of RNA aptamers specific to the NS3 protein of hepatitis C virus from a pool of completely random RNA // Virology. 1997. V.237. P.270–282. 535.
Kumar R., Singh S.K., Koshkin A.A., Rajwanshi V.K., Meldgaard M., Wengel J.
The first analogues of LNA (locked nucleic acids): phosphorothioate-LNA and 2'-thioLNA // Bioorg. Med. Chem. Lett. 1998. V.8. P.2219–2222. 536.
Kumar P.K.R., Suh Y.A., Taira K., Nishikawa S. Point and compensation
mutations to evaluate essential stem structures of genomic HDV ribozyme // FASEB J. 1993. V.7. P.124–129. 537.
Kumar R.K., Yarus M. RNA-catalyzed amino acid activation // Biochemistry.
2001. V.40. P.6998-7004. 538.
Kumarevel T.S., Gopinath S.C.B., Nishikawa S., Mizuno H., Kumar P.K.R.
Identification of important chemical groups of the hut mRNA for HutP interactions that regulate the hut operon in Bacillus subtilis // Nucleic Acids Res. 2004. V.32. P.3904–3912.
120
539.
Kumarevel T., Mizuno H., Kumar P.K.R. Structural basis of HutP-mediated anti-
termination and roles of the Mg2+ ion and L-histidine ligand // Nature. 2005. V.434. P.183–191. 540.
Küpfer P.A., Leumann C.J. The chemical stability of abasic RNA compared to
abasic DNA // Nucleic Acids Res. 2007. V.35. P.58–68. 541.
Kurreck J., Wysko E., Gillen C., Erdmann V.A. Design of antisense
oligonucleotides stabilized by locked nucleic acids // Nucleic Acids Res. 2002. V.30. P.1911–1918. 542.
Kuwabara T., Tanabe T., Warashina M., Xiong K.X., Tani K., Taira K., Asano S.
Allosterically controllable maxizyme-mediated suppression of progression of leukemia in mice // Biomacromolecules. 2001. V.2. P.1220–1228. 543.
Kuwabara T., Warashina M., Taira K. Allosterically controllable ribozymes with
biosensor functions // Curr. Opin. Chem. Biol. 2000. V.4. P.669–677. 544.
Kuwabara T., Warashina M., Tanabe T., Kenzaburo T., Asano S., Taira K. A
novel allosterically trans-activated ribozyme, the maxizyme, with exceptional specificity in vitro and in vivo // Mol. Cell. 1998. V.2. P.617–627. 545.
Kwon M., Chun S.M., Jeong S., Yu J. In vitro selection of RNA against
kanamycin B // Mol. Cells. 2001. V.11. P.303–311. 546.
Laserson U., Gan H.H., Schlick T. Predicting candidate genomic sequences that
correspond to synthetic functional RNA motifs // Nucleic Acids Research. 2005. V.33. P.6057-6069. 547.
Latham M.P., Brown D.J., McCallum S.A., Pardi A. NMR methods for studying
the structure and dynamics of RNA // Chembiochem. 2005. V.6. P.1492–1505. 548.
Latham J.A., Johnson R., Toole J.J. The application of a modified nucleotide in
aptamer selection: novel thrombin aptamers containing 5-(1-pentynyl)-2'-deoxyuridine // Nucleic Acids Res. 1994. V.22. P.2817-2822. 549.
Lato S.M., Boles A.R., Ellington A.D. In vitro selection of RNA lectins: using
combinatorial chemistry to interpret ribozyme evolution // Chem. Biol. 1995. V.2. P.291-303.
121
550.
Lato S.M., Ellington A.D. Screening chemical libraries for nucleic-acid-binding
drugs by in vitro selection: a test case with lividomycin // Mol. Divers. 1996. V.2. P.103-110. 551.
Lau M.W.L., Cadieux K.E.C., Unrau P.J. Isolation of fast purine nucleotide
synthase ribozymes // J. Am. Chem. Soc. 2004. V.126. P.15686–15693. 552.
Lauhon C.T., Szostak J.W. RNA aptamers that bind flavin and Nicotinamide redox
cofactors // J. Am. Chem. Soc. 1995. V.117. P.1246–1257. 553.
Lebruska L.L., Maher L.J., 3rd. Selection and characterization of an RNA decoy
for transcription factor NF-κB // Biochemistry. 1999. V.38. P.3168-3174. 554.
Legault P., Li J., Mogridge J., Kay L.E., Greenblatt J. // Cell. 1998. V.93. P.289.
555.
Lee J.F., Hesselberth J.R., Meyers L.A., Ellington A.D. Aptamer database //
Nucleic Acids Res. 2004. V.32. P.D95–D100. 556.
Lee J.F., Stovall G.M., Ellington A.D. Aptamer therapeutics advance // Curr.
Opin. Chem. Biol. 2006. V.10. P.282-289. 557.
Lee J.-H., Canny M.D., De Erkenez A., Krilleke D., Ng Y.-S., Shima D.T., Pardi
A., Jucker F.. A therapeutic aptamer inhibits angiogenesis by specifically targeting the heparin binding domain of VEGF165 // PNAS. 2005. V.102. P.18902-18907. 558.
Lee M., Walt D.R. A fiber-optic microarray biosensor using aptamers as receptors
// Anal. Biochem. 2000. V.282. P.142–146. 559.
Lee N., Bessho Y., Wei K., Szostak J.W., Suga H. Ribozyme-catalyzed tRNA
aminoacylation // Nat. Struct. Biol. 2000. V.7. P.28-33. 560.
Lee S.W., Sullenger B.A. Isolation of a nuclease-resistant decoy RNA that
selectively blocks autoantibody binding to insulin receptors on human lymphocytes // J. Exp. Med. 1996. V.184. P.315-324. 561.
Lee S.W., Sullenger B.A. Isolation of a nuclease-resistant decoy RNA that can
protect human acetylcholine receptors from myasthenic antibodies // Nat. Biotechnol. 1997. V.15. P.41-45. 562.
Leeper T.C., Varani G. The structure of an enzyme-activating fragment of human
telomerase RNA // RNA. 2005. V.11. P.394–403. 563.
Legault P., Hoogstraten C.G., Metlitzky E., Pardi A. Order, dynamics and
metalbinding in the lead-dependent ribozyme // J. Mol. Biol. 1998. V.284. P.325-335.
122
564.
Legiewicz M., Lozupone C., Knight R., Yarus M. Size, constant sequences, and
optimal selection // RNA. 2005. V.11. P.1701-1709. 565.
Lemay J.-F., Lafontaine D.A. Core requirements of the adenine riboswitch
aptamer for ligand binding // RNA. 2007. V.13. P.339–350. 566.
Leva S., Lichte A., Burmeister J., Muhn P., Jahnke B., Fesser D., Erfurth J.,
Burgstaller P., Klussmann S. GnRH binding RNA and DNA Spiegelmers: a novel approach toward GnRH antagonism // Chem. Biol. 2002. V.9. P.351-359. 567.
Levy M, Ellington AD. ATP-dependent allosteric DNA enzymes // Chem. Biol.
2002. V.9. P.417–426. 568.
Levy M., Griswold K.E., Ellington A.D. Direct selection of trans-acting ligase
ribozymes by in vitro compartmentalization // RNA. 2005. V.11. P.1555-1562. 569.
Li J.J., Herskowitz I. Isolation of ORC6, a component of the yeast origin
recognition complex by a one-hybrid system // Science. 1993. V.262. P.1870–1874. 570.
14. Li Y., Breaker R.R. // Curr. Opin. Struct. Biol. 1999. V.9. P.315.
571.
Li Y., Geyer C.R., Sen D. Recognition of anionic porphyrins by DNA aptamers //
Biochemistry. 1996. V.35. P.6911-6922. 572.
Li Y., Lee H.J., Corn R.M.. Fabrication and characterization of RNA aptamer
microarrays for the study of protein-aptamer interactions with SPR imaging // Nucleic Acids Res. 2006. V.34. P.6416-6424. 573.
Li Y., Liu Y., Breaker R.R. Capping DNA with DNA // Biochemistry. 2000. V.39.
P.3106–3114. 574.
Li Y., Sen D. A catalytic DNA for porphyrin metallation // Nat. Struct. Biol. 1996.
V.3. P.743-747. 575.
Li Y., Zhang C., Li B., Zhao L., Li X., Yang W., Xu S. Ultrasensitive
Densitometry Detection of Cytokines with Nanoparticle-Modified Aptamers // Clin. Chem. 2007. V.53. P.1061-1066. 576.
Lin C.H., Patel D.J. Structural basis of DNA folding and recognition in an AMP-
DNA aptamer complex: distinct architectures but common recognition motifs for DNA and RNA aptamers complexed to AMP // Chem. Biol. 1997. V.4. P.817–832. 577.
Lin C.H., Patel D.J. Encapsulating an amino acid in a DNA fold // Nat. Struct.
Biol. 1996. V.3. P.1046-1050.
123
578.
Lin C.H., Wang W., Jones R.A., Patel D.J. Formation of an amino-acid-binding
pocket through adaptive zippering-up of a large DNA hairpin loop // Chem. Biol. 1998. V.5. P.555-572. 579.
Lin L., Wang H., Liu Y., Yan H., Lindsay S. Recognition Imaging with a DNA
Aptamer // Biophys. J. 2006. V.90. P.4236-4238. 580.
Lin N., Yan J., Huang Z., Altier C., Li M., Carrasco N., Suyemoto M., Johnston
L., Wang S., Wang Q., et al. Design and synthesis of boronic-acid-labeled thymidine triphosphate for incorporation into DNA // Nucleic Acids Res. 2007. V.35. P.12221229. 581.
Lin Y., Nieuwlandt D., Magallanez A., Feistner B., Jayasena S.D. High-affinity
and specific recognition of human thyroid stimulating hormone (hTSH) by in vitroselected 2'-amino-modified RNA // Nucleic Acids Res. 1996. V.24. P.3407-3414. 582.
Lin Y., Qiu Q., Gill S.C., Jayasena S.D. Modified RNA sequence pools for in vitro
selection // Nucleic Acids Res. 1994. V.22. P.5229-5234. 583.
Liss M., Petersen B., Wolf H., Prohaska E. An aptamer-based quartz crystal
protein biosensor // Anal. Chem. 2002. V.74. P.4488–4495. 584.
Liu J., Lu Y. Adenosine-Dependent Assembly of Aptazyme-Functionalized Gold
Nanoparticles and Its Application as a Colorimetric Biosensor // Anal. Chem. 2004. V.76. P.1627-1632. 585.
Liu J.W., Mazumdar D., Lu Y. A simple and sensitive "dipstick" test in serum
based on lateral flow separation of aptamer-linked nanostructures // Angew. Chem. Int. Ed. Engl. 2006. V.45. P.7955–7959. 586.
Liu J., Stormo G.D. Combining SELEX with quantitative assays to rapidly obtain
accurate models of protein-DNA interactions // Nucleic Acids Res. 2005. V.33. P.e141. 587.
Liu X.M., Cao G., Ding H., Zhang D., Yang G., Liu N., Fan M., Shen B., Shao N.
Screening of functional antidotes of RNA aptamers against bovine thrombin // FEBS Lett. 2004. V.562. P.125–128. 588.
Liu X., Lee C.-K., Granek J.A., Clarke N.D., Lieb J.D. Whole-genome comparison
of Leu3 binding in vitro and in vivo reveals the importance of nucleosome occupancy in target site selection // Genome Res. 2006. V.16. P.1517-1528.
124
589.
Liu X.M., Zhang D., Cao G., Yang G., Ding H., Liu G., Fan M., Shen B., Shao N.
RNA aptamers specific for bovine thrombin // J. Mol. Recognit. 2003. V.16. P.23–27. 590.
Liu Y., Sen D. Light-regulated catalysis by an RNA-cleaving deoxyribozyme // J.
Mol. Biol. 2004. V.341. P.887-892. 591.
Lohse P.A., Szostak J.W. Ribozyme-catalysed amino-acid transfer reactions //
Nature. 1996. V.381. P.442-444. 592.
Lorger M., Engstler M., Homann M., Goringer H.U. Targeting the variable surface
of African trypanosomes with variant surface glycoprotein-specific, serum-stable RNA aptamers // Eukaryot. Cell. 2003. V.2. P.84-94. 593.
Lorsch J.R., Szostak J.W. In vitro evolution of new ribozymes with polynucleotide
kinase activity // Nature. 1994. V.371. P.31-36. 594.
Lorsch J.R., Szostak J.W. In vitro selection of RNA aptamers specific for
cyanocobalamin // Biochemistry. 1994. V.33. P.973-982. 595.
15. Lorsch J.R., Szostak J.W. Chance and necessity in the selection of nucleic acid
catalysts // Acc. Chem. Res. 1996. V.29. P.103–110. 596.
Lowy R.J., Sarkar D.P., Chen Y., Blumenthal R. Observation of single influenza
virus–cell fusion and measurement by fluorescence video microscopy // Proc. Natl. Acad. Sci. USA. 1990. V.87. P.1850–1854. 597.
Lozupone C., Changayil S., Majerfeld I., Yarus M. Selection of the simplest RNA
that binds isoleucine // RNA. 2003. V.9. P.1315–1322. 598.
Lukavsky P.J., Puglisi J.D. RNAPack: An integrated NMR approach to RNA
structure determination // Methods. 2001. V.25. P.316–332. 599.
Lupold S.E., Hicke B.J., Lin Y., Coffey D.S. Identification and characterization of
nuclease-stabilized RNA molecules that bind human prostate cancer cells via the prostate-specific membrane antigen // Cancer Res. 2002. V.62. P.4029-4033. 600.
Macaya R.F., Schultze P., Smith F.W., Roe J.A., Feigon J. Thrombin-binding
DNA aptamer forms a unimolecular quadruplex structure in solution // Proc. Natl. Acad. Sci. USA. 1993. V.90. P.3745-3749. 601.
Macrae I.J., Zhou K., Li F., Repic A., Brooks A.N., Cande W.Z., Adams P.D.,
Doudna J.A. Structural basis for double-stranded RNA processing by Dicer // Science. 2006. V.311. P.195–198.
125
602.
Majerfeld I., Yarus M. A diminutive and specific RNA binding site for L-
tryptophan // Nucleic Acids Res. 2005. V.33. P.5482-5493. 603.
Majerfeld I., Yarus M. Isoleucine:RNA sites with associated coding sequences //
RNA. 1998. V.4. P.471–478. 604.
Majerfeld I., Yarus M. An RNA pocket for an aliphatic hydrophobe // Nat. Struct.
Biol. 1994. V.1. P.287-292. 605.
Mandal M., Boese B., Barrick J.E., Winkler W.C., Breaker R.R. Riboswitches
control fundamental biochemical pathways in Bacillus subtilis and other bacteria // Cell. 2003. V.113. P.577–586. 606.
Mandal M., Breaker R.R. Gene regulation by riboswitches // Nature Rev. Mol.
Cell Biol. 2004. V.5. P.451–463. 607.
Manimala J.C., Wiskur S.L., Ellington A.D., Anslyn E.V. Tuning the specificity of
a synthetic receptor using a selected nucleic Acid receptor // J. Am. Chem. Soc. 2004. V.126. P.16515-16519. 608.
Mann D., Reinemann C., Stoltenburg R., Strehlitz B. In vitro selection of DNA
aptamers binding ethanolamine // Biochem. Biophys. Res. Commun. 2005. V.338. P.1928-1934. 609.
Mannironi C., Di Nardo A., Fruscoloni P., Tocchini-Valentini G.P. In vitro
selection of dopamine RNA ligands // Biochemistry. 1997. V.36. P.9726–9734. 610.
Mannironi C., Scerch C., Fruscoloni P., Tocchini-Valentini G.P. Molecular
recognition of amino acids by RNA aptamers: the evolution into an L-tyrosine binder of a dopamine-binding RNA motif // RNA. 2000. V.6. P.520–527. 611.
Marschall P., Thomson J.B., Eckstein F. // Cell. Mol. Neurobiol. 1994. V.14.
P.523–538. 612.
Masud M.M., Kuwahara M., Ozaki H., Sawai H. Sialyllactose-binding modified
DNA aptamer bearing additional functionality by SELEX // Bioorg. Med. Chem. 2004. V.12. P.1111-1120. 613.
Mathews H., Sabina J., Zuker M., Turner D.H. Expanded sequence dependence of
thermodynamic parameters improves prediction of RNA secondary structure // J. Mol. Biol. 1999. V.288. P.911–940.
126
614.
Matsugami A., Kobayashi S., Ouhashi K., Uesugi S., Yamamoto R., Taira K.,
Nishikawa S., Kumar P.K.R., Katahira M. Structural basis of the highly efficient trapping of the HIV Tat protein by an RNA aptamer // Structure. 2003. V.11. P.533– 545. 615.
Mattick J.S., Mankunin I.V. Small regulatory RNAs in mammals // Hum. Mol.
Genet. 2005. V.14. P.R121–R132. 616.
Mayer G., Wulffen B., Huber C., Brockmann J., Flicke B., Neumann L.,
Hafenbradl D., Klebl B.M., Lohse M.J., Krasel C., et al. An RNA molecule that specifically inhibits G-protein-coupled receptor kinase 2 in vitro // RNA. 2008. V.14. P.524-534. 617.
Mayer O., Rajkowitsch L., Lorenz C., Konrat R., Schroeder R. RNA chaperone
activity and RNA-binding properties of the E. coli protein StpA // Nucleic Acids Res. 2007. P.35. P.1257-1269. 618.
McCall M.J., Hendry P., Mir A.A., Conaty J., Brown G., Lockett T.J. Small,
efficient hammerhead ribozymes // Mol. Biotechnol. 2000. V.14. P.15–17. 619.
McGregor A., Murray J.B., Adams C.J., Stockley P.G., Connolly B.A. Secondary
structure mapping of an RNA ligand that has high affinity for the MetJ repressor protein and interference modification analysis of the protein-RNA complex // J. Biol. Chem. 1999. V.274. P.2255-2262. 620.
Meister G., Tuschl T. Mechanisms of gene silencing by double-stranded RNA //
Nature. 2004. V.431. P.343–349. 621.
Meister G., Landthaler M., Dorsett Y., Tuschl T. Sequence-specific inhibition of
microRNA- and siRNA-induced RNA silencing // RNA. 2004. V.10. P.544–550. 622.
Meli M., Vergne J., Decout J.L., Maurel M.C. Adenine–aptamer complexes: a
bipartite RNA site that binds the adenine nucleic base // J. Biol. Chem. 2002. V.277. P.2104–2111. 623.
Mello C.C., Conte D. Jr. Revealing the world of RNA interference // Nature. 2004.
V.431. P.338–342. 624.
Mendonsa S.D., Bowser M.T. In vitro evolution of functional DNA using capillary
electrophoresis // J. Am. Chem. Soc. 2004. V.126. P.20-21.
127
625.
Mescalchin A., Wunsche W., Laufer S.D., Grohmann D., Restle T., Sczakiel G..
Specific binding of a hexanucleotide to HIV-1 reverse transcriptase: a novel class of bioactive molecules // Nucleic Acids Res. 2006. V.34. P.5631-5637. 626.
Meyer M.M., Roth A., Chervin S.M., Garcia G.A., Breaker R.R. Confirmation of a
second natural preQ1 aptamer class in Streptococcaceae bacteria // RNA. 2008. V.14. P.685-695. 627.
Mi J., Zhang X., Giangrande P.H., McNamara J.O., 2nd, Nimjee S.M., Sarraf-
Yazdi S., Sullenger B.A., Clary B.M. Targeted inhibition of αvβ3 integrin with an RNA aptamer impairs endothelial cell growth and survival // Biochem. Biophys. Res. Commun. 2005. V.338. P.956-963. 628.
Mi J., Zhang X., Rabbani Z.N., Liu Y., Su Z., Vujaskovic Z., Kontos C.D.,
Sullenger B.A., Clary B.M. H1 RNA polymerase III promoter-driven expression of an RNA aptamer leads to high-level inhibition of intracellular protein activity // Nucleic Acids Res. 2006. V.34. P.3577-3584. 629.
Michaud M., Jourdan E., Villet A., Ravel A., Grosset C., Peyrin E. A DNA
aptamer as a new target-specific chiral selector for HPLC // J.Am.Chem.Soc. 2003. V.125. P.8672–8679. 630.
Michel F., Hanna M., Green R., Bartel D.P., Szostak J.W. The guanosine binding
site of the Tetrahymena ribozyme // Nature. 1989. V.342. P.391–395. 631.
Miller O.J., Bernath K., Agresti J.J., Amitai G., Kelly B.T., Mastrobattista E., Taly
V., Magdassi S., Tawfik D.S., Griffiths A.D. Directed evolution by in vitro compartmentalization // Nat. Methods. 2006. V.3. P.561-570. 632.
Mironov A.S., Gusarov I., Rafikov R., Lopez L.E., Shatalin K., Kreneva R.A.,
Perumov D.A., Nudler E. Sensing small molecules by nascent RNA: a mechanism to control transcription in bacteria // Cell. 2002. V.111. P.747–756. 633.
Mishra R.K., Le Tinevez R., Toulme J.J. Targeting nucleic acid secondary
structures by antisense oligonucleotides designed through in vitro selection // Proc. Natl. Acad. Sci. USA. 1996. V.93. P.10679-10684. 634.
Misono T.S., Kumar P.K.R. Selection of RNA aptamers against human influenza
virus hemagglutinin using surface plasmon resonance // Anal. Biochem. 2005. V.342. P.312–317.
128
635.
Missailidis S., Thomaidou D., Borbas K.E., Price M.R. Selection of aptamers with
high affinity and high specificity against C595, an anti-MUC1 IgG3 monoclonal antibody, for antibody targeting // J. Immunol. Methods. 2005. V.296. P.45-62. 636.
Miyagishi M., Taira K. U6 promoter driven siRNAs with four uridine 3' overhangs
efficiently suppress targeted gene expression in mammalian cells // Nat. Biotechnol. 2002. V.20. P.497–500. 637.
Miyakawa S., Nomura Y., Sakamoto T., Yamaguchi Y., Kato K., Yamazaki S.,
Nakamura Y. Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G // RNA. 2008. V.14. P.1154-1163. 638.
Miyakawa S., Oguro A., Ohtsu T., Imataka H., Sonenberg N., Nakamura Y. RNA
aptamers to mammalian initiation factor 4G inhibit cap-dependent translation by blocking the formation of initiation factor complexes // RNA. 2006. V.12. P.18251834. 639.
Mizuno T., Kawasaki K., Miyamoto H. Construction of a thermotaxis chamber
providing spatial or temporal thermal gradients monitored by an infrared video camera system // Anal. Biochem. 1992. V.207. P.208–213. 640.
Moazed D., Noller H.F. Interaction of antibiotics with functional sites in 16S
ribosomal RNA // Nature. 1987. V.327. P.389-394. 641.
Montange R.K., Batey R.T. Structure of the S-adenosylmethionine riboswitch
regulatory mRNA element // Nature. 2006. V.441. P.1172–1175. 642.
Moore P.B. // Annu. Rev. Biochem. 1999. V.67. P.287.
643.
Moreno M., Rincón E., Piñeiro D., Fernández G., Domingo A., Jiménez-Ruíz A.,
Salinas M., González V.M. Selection of aptamers against KMP-11 using colloidal gold during the SELEX process // Biochem. Biophys. Res. Commun. 2003. V.308. P.214-218. 644.
Morris K.N., Jensen K.B., Julin C.M., Weil M., Gold L. High affinity ligands from
in vitro selection: complex targets // Proc. Natl. Acad. Sci. USA. 1998. V.95. P.29022907. 645.
Morris K.N., Tarasow T.M., Julin C.M., Simons S.L., Hilvert D., Gold L.
Enrichment for RNA molecules that bind a Diels-Alder transition state analog // Proc. Natl. Acad. Sci. USA. 1994. V.91. P.13028-13032.
129
646.
Mulhbacher J., Lafontaine D.A. Ligand recognition determinants of guanine
riboswitches // Nucleic Acids Research. 2007. V.35. P.1–13. 647.
Muller M., Weigand J.E., Weichenrieder O., Suess B. Thermodynamic
characterization of an engineered tetracycline-binding riboswitch // Nucleic Acids Res. 2006. V.34. P.2607-2617. 648.
Murphy M.B., Fuller S.T., Richardson P.M., Doyle S.A. An improved method for
the in vitro evolution of aptamers and applications in protein detection and purification // Nucleic Acids Res. 2003. V.31. P.e110. 649.
Murray J.B., Collier A.K., Arnold J.R.P. A general purification procedure for
chemically synthesized oligoribonucleotides // Anal. Biochem. 1994. V.218. P.177. 650.
Myszka D.G., Morton T.A. CLAMP: a biosensor kinetic data analysis program //
Trends Biochem. Sci. 1998. V.23. P.149–150. 651.
Nagaswamy U., Larios-Sanz M., Hury J., Collins S., Zhang Z., Zhao Q., Fox G.E.
NCIR: A database of non-canonical interactions in known RNA structures // Nucleic Acids Res. 2002. V.30. P.395– 397. 652.
Nahvi A., Barrick J.E., Breaker R.R. Coenzyme B12 riboswitches are widespread
genetic control elements in prokaryotes // Nucleic Acids Res. 2004. V.32. P.143–150. 653.
Nahvi A., Sudarsan N., Ebert M.S., Zou X., Brown K.L., Breaker R.R. Genetic
control by a metabolite binding mRNA // Chem. Biol. 2002. V.9. P.1043–1049. 654.
Najafi-Shoushtari S.H., Famulok M. Competitive regulation of modular allosteric
aptazymes by a small molecule and oligonucleotide effector // RNA. 2005. V.11. P.1514-1520. 655.
Najafi-Shoushtari S.H., Mayer G., Famulok M. Sensing complex regulatory
networks by conformationally controlled hairpin ribozymes // Nucleic Acids Res. 2004. V.32. P.3212-3219. 656.
Nazarenko I.A., Uhlenbeck O.C. Defining a smaller RNA substrate for elongation
factor Tu // Biochemistry. 1995. V.34. P.2545-2552. 657.
Ng E.W., Shima D.T., Calias P., Cunningham Jr. E.T., Guyer D.R., Adamis A.P.
Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease // Nat. Rev. Drug Discov. 2006. V.5. P.123–132.
130
658.
Nguyen D.H., DeFina S.C., Fink W.H., Dieckmann T. Binding to an RNA aptamer
changes the charge distribution and conformation of malachite green // J. Am. Chem. Soc. 2002. V.124. P.15081-15084. 659.
Nickens D.G., Patterson J.T., Burke D.H. Inhibition of HIV-1 reverse transcriptase
by RNA aptamers in Escherichia coli // RNA. 2003. V.9. P.1029–1033. 660.
Nielsen P.E. // J. Mol. Recog. 1990. V.3. P.1–25.
661.
Nieuwlandt D., Wecker M., Gold L. In vitro selection of RNA ligands to substance
P // Biochemistry. 1995. V.34. P.5651-5659. 662.
Nieuwlandt D., West M., Cheng X., Kirshenheuter G., Eaton B.E. The First
Example of an RNA Urea Synthase: Selection through the Enzyme Active Site of Human Neutrophile Elastase // ChemBioChem. 2003. V.4. P.651-654. 663. and
Nikonowicz E., Sirr A., Legault P., Jucker F., Baer L., Pardi A. Preparation of 13C 15
N labeled RNAs for heteronuclear multi-dimensional NMR studies // Nucleic
Acids Res. 1992. V.20. P.4507– 4513. 664.
Nimjee S.M., Rusconi C.P., Sullenger B.A. Aptamers: an emerging class of
therapeutics // Annu. Rev. Med. 2005. V.56. P.555-583. 665.
Ninichuk V., Clauss S., Kulkarni O., Schmid H., Segerer S., Radomska E.,
Eulberg D., Buchner K., Selve N., Klussmann S., et al. Late Onset of Ccl2 Blockade with the Spiegelmer mNOX-E36-3'PEG Prevents Glomerulosclerosis and Improves Glomerular Filtration Rate in db/db Mice // Am. J. Pathol. 2008. V.172. P.628-637. 666.
Nishikawa F., Funaji K., Fukuda K., Nishikawa S. In vitro selection of RNA
aptamers against the HCV NS3 helicase domain // Oligonucleotides. 2004. V.14. P.114–129. 667.
Nishikawa F., Kakiuchi N., Funaji K., Fukuda K., Sekiya S., Nishikawa S.
Inhibition of HCV NS3 protease by RNA aptamers in cells // Nucleic Acids Res. 2003. V.31. P.1935–1943. 668.
Nix J., Sussman D., Wilson C. The 1.3 Å crystal structure of a biotin-binding
pseudoknot and the basis for RNA molecular recognition // J. Mol. Biol. 2000. V.296. P.1235-1244.
131
669.
Noeske J., Buck J., Furtig B., Nasiri H.R., Schwalbe H., Wohnert J. Interplay of
'induced fit' and preorganization in the ligand induced folding of the aptamer domain of the guanine binding riboswitch // Nucleic Acids Res. 2007. V.35. P.572-583. 670.
Nolte A., Klussmann S., Bald R., Erdmann V.A., Furste J.P. Mirror-design of L-
oligonucleotide ligands binding to L-arginine // Nat Biotechnol. 1996. V.14. P.1116– 1119. 671.
Nonin S., Jiang F., Patel D.J. Imino proton exchange and base-pair kinetics in the
AMP-RNA aptamer complex // J. Mol. Biol. 1997. V.268. P.359-374. 672.
Nonin-Lecomte S., Lin C.H., Patel D.J. Additional hydrogen bonds and base-pair
kinetics in the symmetrical AMP-DNA aptamer complex // Biophys. J. 2001. V.81. P.3422-3431. 673.
Nowakowski J., Shim P.J., Prasad G.S., Stout C.D., Joyce G.F. Crystal structure of
an 82-nucleotide RNA-DNA complex formed by the 10-23 DNA enzyme // Nat. Struct. Biol. 1999. V.6. P.151-156. 674.
Noyes M.B., Meng X., Wakabayashi A., Sinha S., Brodsky M.H., Wolfe S.A. A
systematic characterization of factors that regulate Drosophila segmentation via a bacterial one-hybrid system // Nucleic Acids Res. 2008. V.36. P.2547-2560. 675.
Nudler E., Mironov A.S. The riboswitch control of bacterial metabolism // Trends
Biochem. Sci. 2004. V.29. P.11–17. 676.
Nutiu R., Li Y. Structure-switching signaling aptamers // J. Am. Chem. Soc. 2003.
V.125. P.4771–4778. 677.
Nutiu R., Li Y.F. In vitro selection of structure-switching signaling aptamers //
Angew. Chem. Int. Ed. Engl. 2005. V.44. P.1061–1065. 678.
Nutiu R., Mei S., Liu Z.J., Li Y.F. Engineering DNA aptamers and DNA enzymes
with fluorescence-signaling properties // Pure Appl. Chem. 2004. V.76. P.1547–1561. 679.
O'Connell D., Koenig A., Jennings S., Hicke B., Han H.L., Fitzwater T., Chang
Y.F., Varki N., Parma D., Varki A. Calcium-dependent oligonucleotide antagonists specific for L-selectin // Proc. Natl. Acad. Sci. USA. 1996. V.93. P.5883-5887. 680.
Ohuchi S.P., Ohtsu T., Nakamura Y. Selection of RNA aptamers against
recombinant transforming growth factor-β type III receptor displayed on cell surface // Biochimie. 2006. V.88. P.897-904.
132
681.
Ordoukhanian P., Joyce G.F. A molecular description of the evolution of
resistance // Chem. Biol. 1999. V.6. P.881-889. 682.
Osborne S.E., Ellington A.D. Nucleic Acid Selection and the Challenge of
Combinatorial Chemistry // Chem. Rev. 1997. V.97. P.349-370. 683.
Osborne S.E., Matsumura I., Ellington A.D. Aptamers as therapeutic and
diagnostic reagents: problems and prospects // Curr. Opin. Chem. Biol. 1997. V.1. P.5–9. 684.
O'Sullivan C.K. Aptasensors--the future of biosensing? // Anal. Bioanal. Chem.
2002. V.372. P.44–48. 685.
Ottink O.M., Rampersad S.M., Tessari M., Zaman G.J.R., Heus H.A., Wijmenga
S.S. Ligand-induced folding of the guanine-sensing riboswitch is controlled by a combined predetermined–induced fit mechanism // RNA. 2007. V.13. P.2202-2212. 686.
Padmanabhan K., Padmanabhan K.P., Ferrara J.D., Sadler J.E., Tulinsky A. The
structure of α-thrombin inhibited by a 15-mer single-stranded DNA aptamer // J. Biol. Chem. 1993. V.268. P.17651-17654. 687.
Padmanabhan K., Tulinsky A. An ambiguous structure of a DNA 15-mer thrombin
complex // Acta Crystallogr. D. 1996. V.52. P.272-282. 688.
Pagratis N.C., Bell C., Chang Y.F., Jennings S., Fitzwater T., Jellinek D., Dang C.
Potent 2'-amino-, and 2'-fluoro-2'-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor // Nat. Biotechnol. 1997. V.15. P.68-73. 689.
Pakleza C., Cognet J.A.H. Biopolymer Chain Elasticity: a novel concept and a
least deformation energy principle predicts backbone and overall folding of DNA TTT hairpins in agreement with NMR distances // Nucleic Acids Res. 2003. V.31. P.10751085. 690.
Pan J., Thirumalai D., Woodson S.A. Magnesium-dependent folding of self-
splicing RNA: exploring the link between cooperativity, thermodynamics and kinetics // Proc. Natl Acad. Sci. USA. 1999. V.96. P.6149–6154. 691.
16. T. Pan, Curr. Opin. Chem. Biol. 1, 17 (1997).
692.
Pan T., Uhlenbeck O.C. A small metalloribozyme with a two-step mechanism //
Nature. 1992. V.358. P.560-563.
133
693.
Pan T., Uhlenbeck O.C. In vitro selection of RNAs that undergo autolytic cleavage
with Pb2+ // Biochemistry. 1992. V.31. P.3887-3895. 694.
Pan Q., Zhang X.-L., Wu H.-Y., He P.-W., Wang F., Zhang M.-S., Hu J.-M., Xia
B., Wu J. Aptamers That Preferentially Bind Type IVB Pili and Inhibit Human Monocytic-Cell Invasion by Salmonella enterica Serovar Typhi // Antimicrob. Agents Chemother. 2005. V.49. P.4052-4060. 695.
Pan W., Craven R.C., Qiu Q., Wilson C.B., Wills J.W., Golovine S., Wang J.F.
Isolation of virus-neutralizing RNAs from a large pool of random sequences // Proc. Natl. Acad. Sci. USA. 1995. V.92. P.11509-11513. 696.
Patel D.J. // Curr. Opin. Struct. Biol. 1999. V.9. P.74.
697.
Patel D.J., Suri A.K. Structure, recognition and discrimination in RNA aptamer
complexes with cofactors, amino acids, drugs and aminoglycoside antibiotics // J. Biotechnol. 2000. V.74. P.39–60. 698.
Patel D.J., Suri A.K., Jiang F., Jiang L., Fan P., Kumar R.A., Nonin S. Structure,
recognition and adaptive binding in RNA aptamer complexes // J. Mol. Biol. 1997. V.272. P.645–664. 699.
Paul N., Springsteen G., Joyce G.F. Conversion of a ribozyme to a deoxyribozyme
through in vitro evolution // Chem. Biol. 2006. V.13. P.329-338. 700.
Pearson N.D., Prescott C.D. RNA as a drug target // Chem. Biol. 1997. V.4.
P.409–414. 701.
Peeters E., Wartel C., Maes D., Charlier D. Analysis of the DNA-binding
sequence specificity of the archaeal transcriptional regulator Ss-LrpB from Sulfolobus solfataricus by systematic mutagenesis and high resolution contact probing // Nucleic Acids Res. 2007. V.35. P.623-633 702.
Pei D.H., Ulrich H.D., Schultz P.G. A combinatorial approach toward DNA
recognition // Science. 1991. V.253. P.1408-1411. 703.
Penchovsky R., Breaker R.R. Computational design and experimental validation
of oligonucleotide-sensing allosteric ribozymes // Nat. Biotechnol. 2005. V.23. P.1424-1433. 704.
Peng C.G., Damha M.J. G-quadruplex induced stabilization by 2'-deoxy-2'-fluoro-
D-arabinonucleic acids (2'F-ANA) // Nucleic Acids Res. 2007. V.35. P.4977-4988.
134
705.
Peracchi A., Beigelman L., Usman N., Herschlag D. Rescue of abasic
hammerhead ribozymes by exogenous addition of specific bases // Proc. Natl Acad. Sci. USA. 1996. V.93. P.11522–11527. 706.
Perrin D.M., Garestier T., Helene C. Bridging the Gap between Proteins and
Nucleic Acids: A Metal-Independent RNAseA Mimic with Two Protein-Like Functionalities // J. Am. Chem. Soc. 2001. V.123. P.1556-1563. 707.
Pestourie C., Tavitian B., Duconge F. Aptamers against extracellular targets for in
vivo applications // Biochimie. 2005. V.87. P.921-930. 708.
Petersen M., Wengel J. LNA: a versatile tool for therapeutics and genomics //
Trends Biotechnol. 2003. V.21. P.74–81. 709.
Pieken W.A., Olsen D.B., Benseler F., Aurup H., Eckstein F. Kinetic
characterization of ribonuclease-resistant 2'-modified hammerhead ribozymes // Science. 1991. V.253. P.314–317. 710.
Piganeau N., Jenne A., Thuillier V., Famulok M. An Allosteric Ribozyme
Regulated by Doxycycline // Angew. Chem. Int. Ed. 2000. V.39. P.4369-4373. 711.
Piganeau N., Schroeder R. Aptamer structures. A preview into regulatory
pathways? // Chem. Biol. 2003. V.10. P.103–104. 712.
Piganeau N., Thuillier V., Famulok M. In vitro selection of allosteric ribozymes:
theory and experimental validation // J. Mol. Biol. 2001. V.312. P.1177-1190. 713.
Pileur F., Andreola M.L., Dausse E., Michel J., Moreau S., Yamada H.,
Gaidamakov S.A., Crouch R.J., Toulme J.J., Cazenave C. Selective inhibitory DNA aptamers of the human RNase H1 // Nucleic Acids Res. 2003. V.31. P.5776-5788. 714.
Plummer K.A., Carothers J.M., Yoshimura M., Szostak J.W., Verdine G.L. In
vitro selection of RNA aptamers against a composite small molecule-protein surface // Nucleic Acids Res. 2005. V.33. P.5602-5610. 715.
Ponthier J.L., Schluepen C., Chen W., Lersch R.A., Gee S.L., Hou V.C., Lo A.J.,
Short S.A., Chasis J.A., Winkelmann J.C., et al. Fox-2 Splicing Factor Binds to a Conserved Intron Motif to Promote Inclusion of Protein 4.1R Alternative Exon 16 // J. Biol. Chem. 2006. V.281. P.12468-12474. 716.
Porta H., Lizardi P.M. An allosteric hammerhead ribozyme // Biotechnology.
1995. V.13. P.161–164.
135
717.
Potyrailo R.A., Conrad R.C., Ellington A.D., Hieftje G.M. Adapting selected
nucleic acid ligands (aptamers) to biosensors // Anal. Chem. 1998. V.70. P.3419– 3425. 718.
Proske D., Blank M., Buhmann R., Resch A. Aptamers: Basic research, drug
development, and clinical applications // Appl. Microbiol. Biotechnol. 2005. V.69. P.367–374. 719.
Proske D., Gilch S., Wopfner F., Schatzl H.M., Winnacker E.L., Famulok M.
Prion-protein-specific aptamer reduces PrPSc formation // Chembiochemistry. 2002. V.3. P.717–725 720.
Prudent J.R., Uno T., Schultz P.G. Expanding the scope of RNA catalysis //
Science. 1994. V.264. P.1924-1927. 721.
Puglisi J.D., Chen L., Blanchard S., Frankel A.D. // Science. 1995. V.270. P.1200.
722.
Puglisi J.D., Chen L., Frankel A.D., Williamson J.R. // Proc. Natl. Acad. Sci.
USA. 1993. V.90. P.3680. 723.
Puglisi J.D., Williamson J.R. // R. F. Gesteland, T. R. Cech, J. F. Atkins, Eds. The
RNA World. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2nd ed., 1999. P.403-425. 724.
Purschke W.G., Eulberg D., Buchner K., Vonhoff S., Klussmann S. An L-RNA-
based aquaretic agent that inhibits vasopressin in vivo // PNAS. 2006. V.103. P.51735178. 725.
Purschke W.G., Radtke F., Kleinjung F., Klussmann S. A DNA Spiegelmer to
staphylococcal enterotoxin B // Nucleic Acids Res. 2003. V.31. P.3027-3032. 726.
Purtha
W.E.,
Coppins
R.L.,
Smalley
M.K.,
Silverman
S.K.
General
Deoxyribozyme-Catalyzed Synthesis of Native 3‘–5‘ RNA Linkages // J. Am. Chem. Soc. 2005. V.127. P.13124-13125. 727.
Rathbone D.A., Bruce N.C. Microbial transformation of alkaloids // Curr. Opin.
Microbiol. 2002. V.5. P.274–281. 728.
Ravelet C., Grosset C., Peyrin E. Liquid chromatography, electrochromatography
and capillary electrophoresis applications of DNA and RNA aptamers // J. Chromatogr. A. 2006. V.1117. P.1-10.
136
729.
Reader J.S., Joyce G.F. A ribozyme composed of only two different nucleotides //
Nature. 2002. V.420. P.841-844. 730.
Reiter N.J., Maher III L.J., Butcher S.E. DNA mimicry by a high-affinity anti-NF-
{kappa}B RNA aptamer // Nucleic Acids Res. 2008. V.36. P.1227-1236. 731.
Rentmeister A., Bill A., Wahle T., Walter J., Famulok M. RNA aptamers
selectively modulate protein recruitment to the cytoplasmic domain of {beta}secretase BACE1 in vitro // RNA. 2006. V.12. P.1650-1660. 732.
Reynolds A., Leake D., Boese Q., Scaringe S., Marshall W.S., Khvorova A.
Rational siRNA design for RNA interference // Nat. Biotechnol. 2004. V.22. P.326– 330. 733.
Rhie A., Kirby L., Sayer N., Wellesley R., Disterer P., Sylvester I., Gill A., Hope
J., James W., Tahiri-Alaoui A. Characterization of 2'-fluoro-RNA aptamers that bind preferentially to disease-associated conformations of prion protein and inhibit conversion // J. Biol. Chem. 2003. V.278. P.39697-39705. 734.
Richards B., Karpilow J., Dunn C., Peterson I., Maxfield A., Zharkikh L., Abedi
M., Hurlburt A., Hardman J., Hsu F., et al. Genetic Selection for Modulators of a Retinoic-Acid-Responsive Reporter in Human Cells // Genetics. 2003. V.163. P.10471060. 735.
Rimmele M. Nucleic acid aptamers as tools and drugs: recent developments //
Chembiochem. 2003. V.4. P.963–971. 736.
Rink S.M., Shen J.C., Loeb L.A. Creation of RNA molecules that recognize the
oxidative lesion 7,8-dihydro-8-hydroxy-2'-deoxyguanosine (8-oxodG) in DNA // Proc. Natl. Acad. Sci. USA. 1998. V.95. P.11619-11624. 737.
Robertson M.P., Ellington A.D. In vitro selection of an allosteric ribozyme that
transduces analytes to amplicons // Nat. Biotechnol. 1999. V.17. P.62–66. 738.
Robertson M.P., Ellington A.D. Design and optimization of effector-activated
ribozyme ligases // Nucleic Acids Res. 2000. V.28. P.1751–1759. 739.
Robertson M.P., Ellington A.D. In vitro selection of nucleoprotein enzymes // Nat.
Biotechnol. 2001. V.19. P.650–655. 740.
Rogers J., Chang A.H., von Ahsen U., Schroeder R., Davies J. // J. Mol. Biol.
1996. V.259. P.916.
137
741.
Rogers J., Joyce G.F. A ribozyme that lacks cytidine // Nature. 1999. V.402.
P.323-325. 742.
Rogers J., Joyce G.F. The effect of cytidine on the structure and function of an
RNA ligase ribozyme // RNA. 2001. V.7. P.395-404. 743.
Romero-Lopez C., Barroso-delJesus A., Puerta-Fernandez E., Berzal-Herranz A.
Interfering with hepatitis C virus IRES activity using RNA molecules identified by a novel in vitro selection method // Biol. Chem. 2005. V.386. P.183-190. 744.
Rosenstein S.P., Been M.D. Self-cleavage of hepatitis delta virus genomic strand
RNA is enhanced under partially denaturing conditions // Biochemistry. 1990. V.29. P.8011–8016. 745.
Roth A., Breaker R.R. An amino acid as a cofactor for a catalytic polynucleotide //
Proc. Natl. Acad. Sci. USA. 1998. V.95. P.6027-6031. 746.
Rowsell S., Stonehouse N.J., Convery M.A., Adams C.J., Ellington A.D., Hirao I.,
Peabody D.S., Stockley P.G., Phillips S.E.V. Crystal structures of a series of RNA aptamers complexed to the same protein target // Nature Struct. Biol. 1998. V.5. P.970-975. 747.
Roychowdhury-Saha M., Lato S.M., Shank E.D., Burke D.H. Flavin recognition
by an RNA aptamer targeted toward FAD // Biochemistry. 2002. V.41. P.2492-2499. 748.
Ruckman J., Green L.S., Beeson J., Waugh S., Gillette W.L., Henninger D.D.,
Claesson-Welsh L., Janjic N. 2'-Fluoroprymidine RNA-based aptamers to the 165amino acid form of vascular endothelial growth factor (VEGF165) // J. Biol. Chem. 1998. V.273. P.20556–20567. 749.
Rusconi C.P., Roberts J.D., Pitoc G.A., Nimjee S.M., White R.R., Quick G. Jr.,
Scardino E., Fay W.P., Sullenger B.A. Antidote-mediated control of an anticoagulant aptamer in vivo // Nat. Biotechnol. 2004. V.22. P.1423-1428. 750.
Rusconi C.P., Scardino E., Layzer J., Pitoc G.A., Ortel T.L., Monroe D., Sullenger
B.A. RNA aptamers as reversible antagonists of coagulation factor IXa // Nature. 2002. V.419. P.90–94. 751.
Rusconi C.P., Yeh A., Lyerly H.K., Lawson J.H., Sullenger B.A. Blocking the
initiation of coagulation by RNA aptamers to factor VIIa // Thromb. Haemost. 2000. V.84. P.841-848.
138
752.
Russell R., Zhuang X., Babcock H.P., Millett I.S., Doniach S., Chu S., Herschlag
D. Exploring the folding landscape of a structured RNA // Proc. Natl Acad. Sci. USA. 2002. V.99. P.155–160. 753.
Sabeti P.C., Unrau P.J., Bartel D.P. Accessing rare activities from random RNA
sequences: the importance of the length of molecules in the starting pool // Chem. Biol. 1997. V.4. P.767–774. 754.
Saha S., Ansari A.Z., Jarrell K.A., Ptashne M. RNA sequences that work as
transcriptional activating regions // Nucleic Acids Res. 2003. V.31. P.1565-1570. 755.
Saito H., Kourouklis D., Suga H. An in vitro evolved precursor tRNA with
aminoacylation activity // EMBO J. 2001. V.20. P.1797-1806. 756.
Saito H., Suga H. Outersphere and innersphere coordinated metal ions in an
aminoacyl-tRNA synthetase ribozyme // Nucleic Acids Res. 2002. V.30. P.5151-5159. 757.
Sakamoto T., Oguro A., Kawai G., Ohtsu T., Nakamura Y. NMR structures of
double loops of an RNA aptamer against mammalian initiation factor 4A // Nucleic Acids Res. 2005. V.33. P.745-754. 758.
Salehi-Ashtiani K., Szostak J.W. In vitro evolution suggests multiple origins for
the hammerhead ribozyme // Nature. 2001. V.414. P.82–84. 759.
Sandy P., Ventura A., Jacks T. Mammalian RNAi: A practical guide //
Biotechniques. 2005. V.39. P.215–224. 760.
Santoro S.W., Joyce G.F. A general purpose RNA-cleaving DNA enzyme // Proc.
Natl. Acad. Sci. USA. 1997. V.94. P.4262–4266. 761.
Santoro S.W., Joyce G.F., Sakthivel K., Gramatikova S., Barbas C.F. III. RNA
cleavage by a DNA enzyme with extended chemical functionality // J. Am. Chem. Soc. 2000. V.122. P.2433-2439. 762.
Santulli-Marotto S., Nair S.K., Rusconi C., Sullenger B., Gilboa E. Multivalent
RNA aptamers that inhibit CTLA-4 and enhance tumor immunity // Cancer Res. 2003. V.63. P.7483-7489. 763.
Saran D., Frank J., Burke D.H. The tyranny of adenosine recognition among RNA
aptamers to coenzyme A // BMC Evol. Biol. 2003. V.3. P.26. 764.
Sassanfar M., Szostak J.W. An RNA motif that binds ATP // Nature. 1993. V.364.
P.550–553.
139
765.
Sayer N.M., Cubin M., Rhie A., Bullock M., Tahiri-Alaoui A., James W.
Structural determinants of conformationally selective, prion-binding aptamers // J. Biol. Chem. 2004. V.279. P.13102-13109. 766.
Sazani P.L., Larralde R., Szostak J.W. A small aptamer with strong and specific
recognition of the triphosphate of ATP // J. Am. Chem. Soc. 2004. V.126. P.83708371. 767.
Scarabino D., Crisari A., Lorenzini S., Williams K., Tocchini-Valentini G.P. tRNA
prefers to kiss // EMBO J. 1999. V.18. P.4571-4578. 768.
Scaringe S.A., Wincott F.E., Caruthers M.H. Novel RNA synthesis method using
5'-O-silyl-2'-O-orthoester protecting groups // J. Am. Chem. Soc. 1998. V.120. P.11820–11821. 769.
Schlatterer J.C., Stuhlmann F., Jäschke A. Stereoselective synthesis using
immobilized Diels-Alderase ribozymes // Chembiochem. 2003. V.4. P.1089–1092. 770.
Schlosser K., Lam J.C.F., Li Y. Characterization of long RNA-cleaving
deoxyribozymes with short catalytic cores: the effect of excess sequence elements on the outcome of in vitro selection // Nucleic Acids Res. 2006. V.34. P.2445-2454. 771.
Schmidt K.S., Borkowski S., Kurreck J., Stephens A.W., Bald R., Hecht M.,
Friebe M., Dinkelborg L., Erdmann V.A. Application of locked nucleic acids to improve aptamer in vivo stability and targeting function // Nucleic Acids Research. 2004. V.32. P.5757-5765. 772.
Schneider D., Tuerk C., Gold L. Selection of high affinity RNA ligands to the
bacteriophage R17 coat protein // J. Mol. Biol. 1992. V.228. P.862-869. 773.
Schubert S., Gul D.C., Grunert H.P., Zeichhardt H., Erdmann V.A., Kurreck J.
RNA leaving ‗10–23‘ DNAzymes with enhanced stability and activity // Nucleic Acids Res. 2003. V.31. P.5982–5992. 774.
Schultes E.A., Bartel D.P. One sequence, two ribozymes: implications for the
emergence of new ribozyme folds // Science. 2000. V.289. P.448-452. 775.
Schultes E.A., Spasic A., Mohanty U., Bartel D.P. Compact and ordered collapse
of randomly generated RNA sequences // Nat. Struct. Mol. Biol. 2005. V.12. P.1130– 1136.
140
776.
Schultze P., Macaya R.F., Feigon J. Three-dimensional solution structure of the
thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG) // J. Mol. Biol. 1994. V.235. P.1532-1547. 777.
Schwalbe H, Buck J, Furtig B, Noeske J, Wohnert J. Structures of RNA switches:
insight into molecular recognition and tertiary structure // Angew. Chem. Int. Ed. Engl. 2007. V.46. P.1212–1219. 778.
Sclavi B., Sullivan M., Chance M.R., Brenowitz M., Woodson S.A. RNA folding
at millisecond intervals by synchrotron hydroxyl radical footprinting // Science. 1998. V.279. P.1940–1943. 779.
Scott W.G., Finch J.T., Klug A. The crystal structure of an all-RNA hammerhead
ribozyme: a proposed mechanism for RNA catalytic cleavage // Cell. 1995. V.81. P.991–1002. 780.
Seelig B., Jäschke A. A small catalytic RNA motif with Diels-Alderase activity //
Chem. Biol. 1999. V.6. P.167-176. 781.
Seelig B., Keiper S., Stuhlmann F., Jäschke A. Enantioselective Ribozyme
Catalysis of a Bimolecular Cycloaddition Reaction // Angew. Chem. Int. Ed. 2000. V.39. P.4576-4579. 782.
Seetharaman S., Zivarts M., Sudarsan N., Breaker R.R. Immobilized RNA
switches for the analysis of complex chemical and biological mixtures // Nat. Biotechnol. 2001. V.19. P.336–341. 783.
Seiwert, S.D., Nahreini, T.S., Aigner, S., Ahn, N.G., and Uhlenbeck, O.C. (2000)
RNA aptamers as pathway-specific MAP kinase inhibitors. Chem. Biol. 7, 833–843 784.
Sekiya S., Noda K., Nishikawa F., Yokoyama T., Kumar P.K.R., Nishikawa S.
Characterization and Application of a Novel RNA Aptamer against the Mouse Prion Protein // Journal of Biochemistry. 2006. V.139. P.383-390. 785.
Sekkai D., Dausse E., Di Primo C., Darfeuille F., Boiziau C., Toulme J.J. In vitro
selection of DNA aptamers against the HIV-1 TAR RNA hairpin // Antisense Nucleic Acid Drug Dev. 2002. V.12. P.265-274. 786.
Sengle G., Eisenführ A., Arora P.S., Nowick J.S., Famulok M. Novel RNA
catalysts for the Michael reaction // Chem. Biol. 2001. V.8. P.459-473.
141
787.
SenGupta D.J., Zhang B., Kraemer B., Pochart P., Fields S., Wickens M. A three-
hybrid system to detect RNA–protein interactions in vivo // Proc. Natl. Acad. Sci. 1996. V.93. P.8496–8501. 788.
SenGupta D.J., Wickens M., Fields S. Identification of RNAs that bind to a
specific protein using the yeast three-hybrid system // RNA. 1999. V.5. P.596–601. 789.
Septak M. Kinetic studies on depurination and detritylation of CPG-bound
intermediates during oligonucleotide synthesis // Nucleic Acids Res. 1996. V.24. P.3053–3058. 790.
Serganov A., Keiper S., Malinina L., Tereshko V., Skripkin E., Höbartner C.,
Polonskaia A., Phan A.T., Wombacher R., Micura R., Dauter Z., Jäschke A., Patel D.J. Structural basis for Diels-Alder ribozyme-catalyzed carbon-carbon bond formation // Nat. Struct. Mol. Biol. 2005. V.12. P.218-224. 791.
Serganov A., Polonskaia A., Phan A.T., Breaker R.R., Patel D.J. Structural basis
for gene regulation by a thiamine pyrophosphate-sensing riboswitch // Nature. 2006. V.441. P.1167–1171. 792.
Serganov A., Yuan Y.R., Pikovskaya O., Polonskaia A., Malinina L., Phan A.T.,
Hobartner C., Micura R., Breaker R.R., et al. Structural basis for discriminative regulation of gene expression by adenine- and guanine-sensing mRNAs // Chem. Biol. 2004. V.11. P.1729–1741. 793.
Sevilimedu A., Shi H., Lis J.T. TFIIB aptamers inhibit transcription by perturbing
PIC formation at distinct stages // Nucleic Acids Res. 2008. V.36. P.3118-3127. 794.
Shah S., Rangarajan S., Friedman S.H. Light-activated RNA interference //
Angew. Chem. Int. Ed. Engl. 2005. V.44. P.1328–1332. 795.
Shangguan D., Cao Z.C., Li Y., Tan W. Aptamers Evolved from Cultured Cancer
Cells Reveal Molecular Differences of Cancer Cells in Patient Samples // Clin. Chem. 2007. V.53. P.1153-1155. 796.
Shangguan D., Li Y., Tang Z., Cao Z.C., Chen H.W., Mallikaratchy P., Sefah K.,
Yang C.J., Tan W. Aptamers evolved from live cells as effective molecular probes for cancer study // Proc. Natl. Acad. Sci. USA. 2006. V.103. P.11838-11843. 797.
Sheppard T.L., Ordoukhanian P., Joyce G.F. A DNA enzyme with N-glycosylase
activity // Proc. Natl. Acad. Sci. USA. 2000. V.97. P.7802-7807.
142
798.
Shi H., Fan X., Sevilimedu A., Lis J.T. RNA aptamers directed to discrete
functional sites on a single protein structural domain // Proc. Natl. Acad. Sci. USA. 2007. V.104. P.3742-3746. 799.
Shikamoto Y., Morita T., Fujimoto A., Mizuno H. Crystal structure of Mg2+ and
Ca2+-bound Gla domain of factor IX complexed with binding protein // J. Biol. Chem. 2003. V.278. P.24090–24094. 800.
Shimada T., Fujita N., Maeda M., Ishihama A. Systematic search for the Cra-
binding promoters using genomic SELEX system // Genes Cells. 2005. V.10. P.907918. 801.
Shu D., Guo P. A viral RNA that binds ATP and contains a motif similar to an
ATP-binding aptamer from SELEX // J. Biol. Chem. 2003. V.278. P.7119–7125. 802.
Sidorov A.V., Grasby J.A., Williams D.M. Sequence-specific cleavage of RNA in
the absence of divalent metal ions by a DNAzyme incorporating imidazolyl and amino functionalities // Nucleic Acids Res. 2004. V.32. P.1591-1601. 803.
Sievers A., Beringer M., Rodnina M.V., Wolfenden R. The ribosome as an entropy
trap // Proc. Natl. Acad. Sci. USA. 2004. V.101. P.7897-7901. 804.
Silverman S.K. In vitro selection, characterization, and application of
deoxyribozymes that cleave RNA // Nucleic Acids Res. 2005. V.33. P.6151-6163. 805.
Silverman S.K. Rube Goldberg goes (ribo)nuclear? Molecular switches and
sensors made from RNA // RNA. 2003. V.9. P.377-383. 806.
Silverman S.K. Artificial functional nucleic acids: Aptamers, ribozymes, and
deoxyribozymes identified by in vitro selection // Y. Lu and Y. Li, Eds. Functional Nucleic Acids for Sensing and Other Analytical Applications. Springer: New York, 2007. P.1-38. 807.
Siolas D., Lerner C., Burchard J., Ge W., Linsley P.S., Paddison P.J., Hannon G.J.,
Cleary M.A. Synthetic shRNAs as potent RNAi triggers // Nat. Biotechnol. 2005. V.23. P.227–231. 808.
Skehel J.J., Wiley D.C. Receptor binding and membrane fusion in virus entry: the
influenza hemagglutinin // Annu. Rev. Biochem. 2000. V.69. P.531–569.
143
809.
Smith D., Kirschenheuter G.P., Charlton J., Guidot D.M., Repine J.E. In vitro
selection of RNA-based irreversible inhibitors of human neutrophil elastase // Chem. Biol. 1995. V.2. P.741-750. 810.
Soller M., White K. ELAV // Curr. Biol. 2004. V.14. P.R53.
811.
Sooter L.J., Riedel T., Davidson E.A., Levy M., Cox J.C., Ellington A.D. Toward
automated nucleic acid enzyme selection // Biol. Chem. 2001. V.382. P.1327-1334. 812.
Soukup G.A., Breaker R.R. Design of allosteric hammerhead ribozymes activated
by ligand-induced structure stabilization // Struct. Fold. Des. 1999. V.7. P.783–791. 813.
6. Soukup G.A., Breaker R.R. Engineering precision RNA molecular switches //
Proc. Natl. Acad. Sci. 1999. V.96. P.3584–3589. 814.
7. Soukup G.A., Breaker R.R. Nucleic acid molecular switches // Trends
Biotechnol. 1999. V.17. P.469–476. 815.
8. Soukup G.A., Breaker R.R. Allosteric nucleic acid catalysts // Curr. Opin.
Struct. Biol. 2000. V.10. P.318–325. 816.
Soukup G.A., Breaker R.R. Allosteric ribozymes // KruppG. and GaurR.K., Eds.
Ribozyme Biochemistry and Biotechnology. Eaton Publishing, Natick, MA, 2000. P.149–170. 817.
Soukup G.A., DeRose E.C., Koizumi M., Breaker R.R. Generating new
ligandbinding RNAs by affinity maturation and disintegration of allosteric ribozymes // RNA. 2001. V.7. P.524-536. 818.
Soukup G.A., Ellington A.D., Maher L.J. 3rd. Selection of RNAs that bind to
duplex DNA at neutral pH // J. Mol. Biol. 1996. V.259. P.216-228. 819.
Soukup G.A., Emilsson G.A.M., Breaker R.R. Altering molecular recognition of
RNA aptamers by allosteric selection // J. Mol. Biol. 2000. V.298. P.623–632. 820.
Sreedhara A., Li Y., Breaker R.R. Ligating DNA with DNA // J. Am. Chem. Soc.
2004. V.126. P.3454-3460. 821.
Srinivasan J., Cload S.T., Hamaguchi N., Kurz J., Keene S., Kurz M., Boomer
R.M., Blanchard J., Epstein D., Wilson C., Diener J.L. ADP-specific sensors enable universal assay of protein kinase activity // Chem. Biol. 2004. V.11. P.499-508. 822.
Srisawat C., Engelke D.R. Streptavidin aptamers: affinity tags for the study of
RNAs and ribonucleoproteins // RNA. 2001. V.7. P.632-641.
144
823.
Srisawat C., Goldstein I.J., Engelke D.R. Sephadex-binding RNA ligands: rapid
affinity purification of RNA from complex RNA mixtures // Nucleic Acids Res. 2001. V.29. P.e4. 824.
Stage T.K., Hertel K.J., Uhlenbeck O.C. // RNA. 1995. V.1. P.95.
825.
Stanlis K.K.H., McIntosh R. Single-strand DNA Aptamers as Probes for Protein
Localization in Cells // Journal of Histochemistry and Cytochemistry. 2003. V. 51. P.797-808. 826.
Stelzl U., Worm U., Lalowski M., Haenig C., Brembeck F.H., Goehler H.,
Stroedicke M., Zenkner M., Schoenherr A., Koeppen S., et al. A human protein– protein interaction network: A resource for annotating the proteome // Cell. 2005. V.122. P.957–968. 827.
Stojanovic M.N., de Prada P., Landry D.W. Aptamer-based folding fluorescent
sensor for cocaine // J. Am. Chem. Soc. 2001. V.123. P.4928–4931. 828.
Stojanovic M.N., Kolpashchikov D.M. Modular aptameric sensors // J. Am. Chem.
Soc. 2004. V.126. P.9266–9270. 829.
Stojanovic M.N., Landry D.W. Aptamer-based colorimetric probe for cocaine // J.
Am. Chem. Soc. 2002. V.124. P.9678-9679. 830.
Stoltenburg R., Reinemann C., Strehlitz B. FluMag-SELEX as an advantageous
method for DNA aptamer selection // Anal. Bioanal. Chem. 2005. V.383. P.83-91. 831.
Stormo G.D., Ji Y. Do mRNAs act as direct sensors of small molecules to control
their expression? // PNAS. 2001. V.98. P.9465-9467. 832.
5. Storz G. An expanding universe of noncoding RNAs // Science. 2002. V.296.
P.1260–1263. 833.
Striggles J.C., Martin M.B., Schmidt F.J. Frequency of RNA-RNA interaction in a
model of the RNA World // RNA. 2006. V.12. P.353-359. 834.
Sudarsan N., Barrick J.E., Breaker R.R. Metabolite-binding RNA domains are
present in the genes of eukaryotes // RNA. 2003. V.9. P.644–647. 835.
Sudarsan N., Hammond M.C., Block K.F., Welz R., Barrick J.E., Roth A., Breaker
R.R. Tandem Riboswitch Architectures Exhibit Complex Gene Control Functions // Science. 2006. V.314. P.300-304.
145
836.
Sudarsan N., Wickiser J.K., Nakamura S., Ebert M.S., Breaker R.R. An mRNA
structure in bacteria that controls gene expression by binding lysine // Genes Dev. 2003. V.17. P.2688–2697. 837.
Suess B., Fink B., Berens C., Stentz R., Hillen W. A theophylline responsive
riboswitch based on helix slipping controls gene expression in vivo // Nucleic Acids Research. 2004. V.32. P.1610-1614. 838.
Suess B., Hanson S., Berens C., Fink B., Schroeder R., Hillen W. Conditional gene
expression by controlling translation with tetracycline-binding aptamers // Nucleic Acids Res. 2003. V.31. P.1853–1858. 839.
Suga H., Cowan J.A., Szostak J.W. Unusual metal ion catalysis in an
acyltransferase ribozyme // Biochemistry. 1998. V.37. P.10118-10125. 840.
Suga H., Lohse P.A., Szostak J.W. Structural and kinetic characterization of an
acyl transferase ribozyme // J. Am. Chem. Soc. 1998. V.120. P.1151-1156. 841.
Sullenger B.A., Gilboa E. Emerging clinical applications of RNA // Nature. 2002.
V.418. P.252–258. 842.
Sussman D., Nix J.C., Wilson C. The structural basis for molecular recognition by
the vitamin B12 RNA aptamer // Nat. Struct. Biol. 2000. V.7. P.53-57. 843.
Sussman D., Wilson C. A water channel in the core of the vitamin B12 RNA
aptamer // Structure. 2000. V.8. P.719-727. 844.
Szwajkajzer D., Carey J. Molecular and biological constraints on ligand-binding
affinity and specificity // Biopolymers. 1997. V.44. P.181–198. 845.
Tahiri-Alaoui A., Frigotto L., Manville N., Ibrahim J., Romby P., James W. High
affinity nucleic acid aptamers for streptavidin incorporated into bi-specific capture ligands // Nucleic Acids Res. 2002. V.30. P.e45. 846.
Takemura K., Wang P., Vorberg I., Surewicz W., Priola S.A., Kanthasamy A.,
Pottathil R., Chen S.G., Sreevatsan S.. DNA Aptamers That Bind to PrPC and Not PrPSc Show Sequence and Structure Specificity // Experimental Biology and Medicine. 2006. V.231. P.204-214. 847.
Tanabe T., Kuwabara T., Warashina M., Tani K., Taira K., Asano S. Oncogene
inactivation in a mouse model // Nature. 2000. V.406. P.473–474.
146
848.
Tanabe T., Takata I., Kuwabara T., Warashina M., Kawasaki H., Tani K., Ohta S.,
Asano S., Taira K. Maxizymes, novel allosterically controllable ribozymes, can be designed to cleave various substrates // Biomacromolecules. 2000. V.1. P.108–117. 849.
Tang J., Breaker R.R. Examination of the catalytic fitness of the hammerhead
ribozyme by in vitro selection // RNA. 1997. V.3. P.914–925. 850.
Tang J., Breaker R.R. Rational design of allosteric ribozymes // Chem. Biol. 1997.
V.4. P.453–459. 851.
Tang J., Breaker R.R. Mechanism for allosteric inhibition of an ATP-sensitive
ribozyme // Nucleic Acids Res. 1998. V.26. P.4214–4221. 852.
Tang J., Breaker R.R. Structural diversity of self-cleaving ribozymes // Proc. Natl
Acad. Sci. USA. 2000. V.97. P.5784–5789. 853.
Tang J., Xie J., Shao N., Yan Y. The DNA aptamers that specifically recognize
ricin toxin are selected by two in vitro selection methods // Electrophoresis. 2006. V.27. P.1303-1311. 854.
Tao J., Frankel A.D. Arginine-binding RNAs resembling TAR identified by in
vitro selection // Biochemistry. 1996. V.35. P.2229-2238. 855.
Tao J., Frankel A.D. // Proc. Natl. Acad. Sci. USA. 1992. V.89. P.2723.
856.
Tarasow T.M., Kellogg E., Holley B.L., Nieuwlandt D., Tarasow S.L., Eaton B.E.
The effect of mutation on RNA Diels-Alderases // J. Am. Chem. Soc. 2004. V.126. P.11843-11851. 857.
Tarasow T.M., Tarasow S.L., Eaton B.E. RNA-catalysed carbon-carbon bond
formation // Nature. 1997. V.389. P.54-57. 858.
Tavitian B. In vivo imaging with oligonucleotides for diagnosis and drug
development // Gut. 2003. V.52. P.iv40–iv47. 859.
Tawfik D.S., Griffiths A.D. Man-made cell-like compartments for molecular
evolution // Nat. Biotechnol. 1998. V.16. P.652-656. 860.
Taylor S., Stojanovic M.N. Is There a Future for DNA-Based Molecular Devices
in Diabetes Management? // Journal of Diabetes Science and Technology. 2007. V.1. P.440-444. 861.
Teramoto N., Ichinari H., Kawazoe N., Imanishi Y., Ito Y. Peroxidase activity of
in vitro-selected 2'-amino RNAs // Biotechnol. Bioeng. 2001. V.75. P.463-468.
147
862.
Teramoto N., Imanishi Y., Ito Y. In vitro selection of a ligase ribozyme carrying
alkylamino groups in the side chains // Bioconjug. Chem. 2000. V.11. P.744-748. 863.
Teramoto N., Imanishi Y., Ito Y. In Vitro Selection of Ligase Ribozymes
Containing 2'-Amino Groups // Journal of Bioactive and Compatible Polymers. 2000. V.15. P.297-308. 864.
Tereshko V., Skripkin E., Patel D.J. Encapsulating Streptomycin within a small
40-mer RNA // Chem. Biol. 2003. V.10. P.175–187. 865.
Theis M.G., Knorre A., Kellersch B., Moelleken J., Wieland F., Kolanus W.,
Famulok M. Discriminatory aptamer reveals serum response element transcription regulated by cytohesin-2 // Proc. Natl. Acad. Sci. USA. 2004. V.101. P.11221-11226. 866.
Thompson K.M., Syrett H.A., Knudsen S.M., Ellington A.D. Group I aptazymes
as genetic regulatory switches // BMC Biotechnol. 2002. V.2. P.21. 867.
Thore S., Leibundgut M., Ban N. Structure of the eukaryotic thiamine
pyrophosphate riboswitch with its regulatory ligand // Science. 2006. V.312. P.1208– 1211. 868.
Thum O., Jager S., Famulok M. Functionalized DNA: A New Replicable
Biopolymer // Angew. Chem. Int. Ed. 2001. V.40. P.3990-3993. 869.
Tjandra N., Bax A. Direct measurement of distances and angles in biomolecules
by NMR in a dilute liquid crystalline medium // Science. 1997. V.278. P.1111–1114. 870.
Tian Y., Adya N., Wagner S., Giam C.Z., Green M.R., Ellington A.D. Dissecting
protein:protein interactions between transcription factors with an RNA aptamer // RNA. 1995. V.1. P.317-326. 871.
Tok J.B., Cho J., Rando R.R. RNA aptamers that specifically bind to a 16S
ribosomal RNA decoding region construct // Nucleic Acids Res. 2000. V.28. P.29022910. 872.
Tombelli S., Minunni M., Mascini M. Analytical applications of aptamers //
Biosensors & Bioelectronics. 2005. V.20. P.2424–2434. 873.
Tomsic J., McDaniel B.A., Grundy F.J., Henkin T.M. Natural Variability in S-
Adenosylmethionine (SAM)-Dependent Riboswitches: S-Box Elements in Bacillus subtilis Exhibit Differential Sensitivity to SAM In Vivo and In Vitro // Journal of Bacteriology. 2008. V.190. P. 823–833.
148
874.
Tor Y., Hermann T., Westhof E. // Chem. Biol. 1998. V.5. P.R277.
875.
Toulme J.J., Di Primo C., Boucard D. Regulating eukaryotic gene expression with
aptamers // FEBS Lett. 2004. V.567. P.55-62. 876.
Travascio P., Bennet A.J., Wang D.Y., Sen D. A ribozyme and a catalytic DNA
with peroxidase activity: active sites versus cofactor-binding sites // Chem. Biol. 1999. V.6. P.779-787. 877.
Treiber D.K., Rook M.S., Zarrinkar P.P., Williamson J.R. Kinetic intermediates
trapped by native interactions in RNA folding // Science. 1998. V.279. P.1943–1946. 878.
Tsai D.E., Kenan D.J., Keene J.D. In vitro selection of an RNA epitope
immunologically cross-reactive with a peptide // Proc. Natl. Acad. Sci. USA. 1992. V.89. P.8864-8868. 879.
Tsang J., Joyce G.F. In vitro evolution of randomized ribozymes // Methods
Enzymol. 1996. V.267. P.410-426. 880.
Tsang J., Joyce G.F. Specialization of the DNA-cleaving activity of a group I
ribozyme through in vitro evolution // J. Mol. Biol. 1996. V.262. P.31-42. 881.
Tsukiji S., Pattnaik S.B., Suga H. An alcohol dehydrogenase ribozyme // Nat.
Struct. Biol. 2003. V.10. P.713-717. 882.
Tsukiji S., Pattnaik S.B., Suga H. Reduction of an aldehyde by a NADH/Zn2+-
dependent redox active ribozyme // J. Am. Chem. Soc. 2004. V.126. P.5044-5045. 883.
Tucker C.E., Chen L.S., Judkins M.B., Farmer J.A., Gill S.C., Drolet D.W.
Detection and plasma pharmacokinetics of an anti-vascular endothelial growth factor oligonucleotide-aptamer (NX1838) in rhesus monkeys // J. Chromatogr. B. 1999. V.732. P.203-212. 884.
Tuerk C., MacDougal S., Gold L. RNA pseudoknots that inhibit human
immunodeficiency virus type 1 reverse transcriptase // Proc. Natl. Acad. Sci. USA. 1992. V.89. P.6988-6992. 885.
Tuschl T., Eckstein F. Hammerhead ribozymes: importance of stem–loop II for
activity // Proc. Natl Acad. Sci. USA. 1993. V.90. P.6991–6994. 886.
Tuschl T., Sharp P.A., Bartel D.P. Selection in vitro of novel ribozymes from a
partially randomized U2 and U6 snRNA library // EMBO J. 1998. V.17. P.2637-2650. 887.
Uhlenbeck O.C. // Nature Struct. Biol. 1998. V.5. P.174.
149
888.
Uhlenbeck O.C. Less isn't always more // RNA. 2003. V.9. P.1415-1417.
889.
Ule J., Jensen K., Mele A., Darnell R.B. CLIP: A method for identifying protein–
RNA interaction sites in living cells // Methods. 2005. V.37. P.376–386. 890.
Ulrich H. RNA aptamers: From basic science toward therapy // Handb. Exp.
Pharmacol. 2006. V.173. P.305–326. 891.
Ulrich H., Magdesian M.H., Alves M.J., Colli W. In vitro selection of RNA
aptamers that bind to cell adhesion receptors of Trypanosoma cruzi and inhibit cell invasion // J. Biol. Chem. 2002. V.277. P.20756-20762. 892.
Umezawa Y., Shimada T., Kori A., Yamada K., Ishihama A. The Uncharacterized
Transcription Factor YdhM Is the Regulator of the nemA Gene, Encoding NEthylmaleimide Reductase // J. Bacteriol. 2008. V.190. P.5890-5897. 893.
Unrau P.J., Bartel D.P. RNA-catalysed nucleotide synthesis // Nature. 1998.
V.395. P.260-263. 894.
Unrau P.J., Bartel D.P. An oxocarbenium-ion intermediate of a ribozyme reaction
indicated by kinetic isotope effects // Proc. Natl. Acad. Sci. USA. 2003. V.100. P.15393-15397. 895.
Vaidya A., Suga H. Diverse roles of metal ions in acyl-transferase ribozymes //
Biochemistry. 2001. V.40. P.7200-7210. 896.
Vaish N.K., Dong F., Andrews L., Schweppe R.E., Ahn N.G., Blatt L., Seiwert
S.D. Monitoring post-translational modifications of proteins with allosteric ribozymes // Nat. Biotechnol. 2002. V.20. P.810–815. 897.
Vaish N.K., Larralde R., Fraley A.W., Szostak J.W., McLaughlin L.W. A novel,
modification-dependent ATP-binding aptamer selected from an RNA library incorporating a cationic functionality // Biochemistry. 2003. V.42. P.8842–8851. 898.
Valegård K., Liljas L., Fridborg K., Unge T. // Nature. 1990. V.345. P.36.
899.
Valegård K., et al. // J. Mol. Biol. 1997. V.270. P.724.
900.
Valegård K., Murray J.B., Stockley P.G., Stonehouse N.J., Liljas L. // Nature.
1994. V.371. P.623. 901.
Valencia-Sanchez M.A., Liu J., Hannon G.J., Parker R. Control of translation and
mRNA degradation by miRNA and siRNAs // Genes Dev. 2006. V.20. P.515–524.
150
902.
Vater A., Jarosch F., Buchner K., Klussmann S. Short bioactive Spiegelmers to
migraine-associated calcitonin gene-related peptide rapidly identified by a novel approach: tailored-SELEX // Nucleic Acids Res. 2003. V.31. P.e130. 903.
Vater A., Klussmann S. Toward third-generation aptamers: Spiegelmers and their
therapeutic prospects // Curr. Opin. Drug Discov. Devel. 2003. V.6. P.253-261. 904.
Verhelst S.H., Michiels P.J., van der Marel G.A., van Boeckel C.A., van Boom
J.H. Surface plasmon resonance evaluation of various aminoglycoside-RNA hairpin interactions reveals low degree of selectivity // Chembiochem. 2004. V.5. P.937–942. 905.
Vester B., Lundberg L.B., Sorensen M.D., Babu R., Douthwaite S., Wengel J.
LNAzymes: incorporation of LNA-type monomers into DNAzymes markedly increases RNA cleavage // J. Am. Chem. Soc. 2002. V.124. P.13682–13683. 906.
Vianini E., Palumbo M., Gatto B. In vitro selection of DNA aptamers that bind
Ltyrosinamide // Bioorg. Med. Chem. 2001. V.9. P.2543-2548. 907.
Vicens Q., Allen M.A., Gilbert S.D., Reznik B., Gooding A.R., Batey R.T. The
Cech Symposium: A celebration of 25 years of ribozymes, 10 years of TERT, and 60 years of Tom // RNA. 2008. V.14. P.397-403. 908.
Vitreschak A.G., Rodionov D.A., Mironov A.A., Gelfand M.S. Regulation of
riboflavin biosynthesis and transport genes in bacteria by transcriptional and translational attenuation // Nucleic Acids Res. 2002. V.30. P.3141-3151. 909.
Vo N.V., Oh J.-W., Lai M.M.C. Identification of RNA ligands that bind hepatitis
C virus polymerase selectively and inhibit its RNA synthesis from the natural viral RNA templates // Virology. 2003. V.307. P.301. 910.
von Ahsen U., Davies J., Schroeder R. Antibiotic inhibition of group I ribozyme
function // Nature. 1991. V.353. P.368-370. 911.
von Ahsen U., Davies J., Schroeder R. Non-competitive inhibition of group I
intron RNA self-splicing by aminoglycoside antibiotics // J. Mol. Biol. 1992. V.226. P.935-941. 912.
von Ahsen U., Schroeder R. Streptomycin and self-splicing // Nature. 1990. V.346.
P.801.
151
913.
von Ahsen U., Schroeder R. Streptomycin inhibits splicing of group I introns by
competition with the guanosine substrate // Nucleic Acids Res. 1991. V.19. P.22612265. 914.
Vuyisich M., Beal P.A. Controlling protein activity with ligand-regulated RNA
aptamers // Chem. Biol. 2002. V.9. P.907-913. 915.
Wadkins T.S., Been M.D. Core-associated non-duplex sequences distinguishing
the genomic and antigenomic self-cleaving RNAs of hepatitis delta virus // Nucleic Acids Res. 1997. V.25. P.4085–4092. 916.
Wahlestedt C., Salmi P., Good L., Kela J., Johnsson T., Hokfelt T., Broberger C.,
Porreca F., Lai J., Ren K., Ossipov M., Koshkin A., Jakobsen N., Skouv J., Oerum H., Jacobsen M.H., Wengel J. Potent and nontoxic antisense oligonucleotides containing locked nucleic acids // Proc. Natl. Acad. Sci. USA. 2000. V.97. P.5633–5638. 917.
Wallace S.T., Schroeder R. In vitro selection and characterization of streptomycin-
binding RNAs: recognition discrimination between antibiotics // RNA. 1998. V.4. P.112–123. 918.
Wallimann P., Marti T., Fürer A., Diederich F. // Chem. Rev. 1997. V.97. P.1567–
1608. 919.
Wallis M.G., Streicher B., Wank H., von Ahsen U., Clodi E., Wallace S.T.,
Famulok M., Schroeder R. In vitro selection of a viomycin-binding RNA pseudoknot // Chem. Biol. 1997. V.4. P.357-366. 920.
Wallis M.G., von Ahsen U., Schroeder R., Famulok M. A Novel RNA motif for
neomycin recognition // Chem. Biol. 1995. V.2. P.543–552. 921.
Wang D.Y., Lai B.H., Feldman A.R., Sen D. A general approach for the use of
oligonucleotide effectors to regulate the catalysis of RNA-cleaving ribozymes and DNAzymes // Nucleic Acids Res. 2002. V.30. P.1735–1742. 922.
Wang D.Y., Lai B.H., Sen D. A general strategy for effector-mediated control of
RNA-cleaving ribozymes and DNA enzymes // J. Mol. Biol. 2002. V.318. P.33–43. 923.
Wang D.Y., Sen D. A novel mode of regulation of an RNA-cleaving DNAzyme
by effectors that bind to both enzyme and substrate // J. Mol. Biol. 2001. V.310. P.723-734.
152
924.
Wang D.Y., Sen D. Rationally designed allosteric variants of hammerhead
ribozymes responsive to the HIV-1 Tat protein // Comb. Chem. High Throughput Screen. 2002. V.5. P.301–312. 925.
Wang H., Tor Y. // Angew. Chem. Int. Ed. Engl. 1998. V.37. P.109.
926.
Wang J., Jiang H., Liu F. In vitro selection of novel RNA ligands that bind human
cytomegalovirus and block viral infection // RNA. 2000. V.6. P.571-583. 927.
Wang K.Y., Krawczyk S.H., Bischofberger N., Swaminathan S., Bolton P.H. The
tertiary structure of a DNA aptamer which binds to and inhibits thrombin determines activity // Biochemistry. 1993. V.32. P.11285-11292. 928.
Wang K.Y., McCurdy S., Shea R.G., Swaminathan S., Bolton P.H. A DNA
aptamer which binds to and inhibits thrombin exhibits a new structural motif for DNA // Biochemistry. 1993. V.32. P.1899-1904. 929.
Wang Q.S., Unrau P.J. Ribozyme motif structure mapped using random
recombination and selection // RNA. 2005. V.11. P.404-411. 930.
Wang S., White K.A. Riboswitching on RNA virus replication // PNAS. 2007.
V.104. P.10406-10411. 931.
Wang W., Billen L.P., Li Y. Sequence diversity, metal specificity, and catalytic
proficiency of metal-dependent phosphorylating DNA enzymes // Chem. Biol. 2002. V.9. P.507-517. 932.
Wang Y., Killian J., Hamasaki K., Rando R.R. RNA molecules that specifically
and stoichiometrically bind aminoglycoside antibiotics with high affinities // Biochemistry. 1996. V.35. P.12338–12346. 933.
Wang Y., Rando R.R. Specific binding of aminoglycoside antibiotics to RNA //
Chem. Biol. 1995. V.2. P.281–290. 934.
Wang Y., Silverman S.K. Deoxyribozymes That Synthesize Branched and Lariat
RNA // J. Am. Chem. Soc. 2003. V.125. P.6880-6881. 935.
Wang Y., Silverman S.K. Efficient One-Step Synthesis of Biologically Related
Lariat RNAs by a Deoxyribozyme // Angew. Chem. Int. Ed. 2005. V.44. P.5863-5866. 936.
Warner R.G., Hundt C., Weiss S., Turnbull J.E. Identification of the heparan
sulfate binding sites in the cellular prion protein // J. Biol. Chem. 2002. V.277. P.18421–18430.
153
937.
Warren C.L., Kratochvil N.C.S., Hauschild K.E., Foister S., Brezinski M.L.,
Dervan P.B., Phillips Jr. G.N., Ansari A.Z. Defining the sequence-recognition profile of DNA-binding molecules // PNAS. 2006. V.103. P.867-872. 938.
Wecker M., Smith D., Gold L. In vitro selection of a novel catalytic RNA:
characterization of a sulfur alkylation reaction and interaction with a small peptide // RNA. 1996. V.2. P.982-994. 939.
Wedekind J.E., McKay D.B. Crystal structure of a lead-dependent ribozyme
revealing metal binding sites relevant to catalysis // Nat. Struct. Biol. 1999. V.6. P.261-268. 940.
Wedekind J.E., McKay D.B. Crystal structure of the leadzyme at 1.8 Å resolution:
metal ion binding and the implications for catalytic mechanism and allo site ion regulation // Biochemistry. 2003. V.42. P.9554-9563. 941.
Weigand J.E., Sanchez M., Gunnesch E.-B., Zeiher S., Schroeder R., Suess B.
Screening for engineered neomycin riboswitches that control translation initiation // RNA. 2008. V.14. P.89-97. 942.
Weigand J.E., Suess B. Tetracycline aptamer-controlled regulation of pre-mRNA
splicing in yeast // Nucleic Acids Res. 2007. 943.
Weigand B.S., Zerressen A., Schlatterer J.C., Helm M., Jäschke A. // Klussmann
S., Ed. The Aptamer Handbook. Wiley-VCH, Weinheim, 2006. P.211–227. 944.
Weill L., Louis D., Sargueil B. Selection and evolution of NTP-specific aptamers
// Nucleic Acids Res. 2004. V.32. P.5045-5058. 945.
Weinberg Z., Regulski E.E., Hammond M.C., Barrick J.E., Yao Z., Ruzzo W.L.,
Breaker R.R. The aptamer core of SAM-IV riboswitches mimics the ligand-binding site of SAM-I riboswitches // RNA. 2008. V.14. P.822-828. 946.
Weinger J.S., Parnell K.M., Dorner S., Green R., Strobel S.A. Substrate-assisted
catalysis of peptide bond formation by the ribosome // Nat. Struct. Mol. Biol. 2004. V.11. P.1101-1106. 947.
Weiss S., Proske D., Neumann M., Groschup M.H., Kretzschmar H.A., Famulok
M., Winnacker E.L. RNA aptamers specifically interact with the prion protein PrP // J. Virol. 1997. V.71. P.8790–8797.
154
948.
Welz R., Breaker R.R. Ligand binding and gene control characteristics of tandem
riboswitches in Bacillus anthracis // RNA. 2007. V.13. P.573–582. 949.
Werstuck G., Green M.R. Controlling gene expression in living cells through
small molecule-RNA interactions // Science. 1998. V.282. P.296–298. 950.
White R., Rusconi C., Scardino E., Wolberg A., Lawson J., Hoffman M.,
Sullenger B. Generation of species cross-reactive aptamers using "toggle" SELEX // Mol. Ther. 2001. V.4. P.567-573. 951.
White R.R., Shan S., Rusconi C.P., Shetty G., Dewhirst M.W., Kontos C.D.,
Sullenger B.A. Inhibition of rat corneal angiogenesis by a nuclease-resistant RNA aptamer specific for angiopoietin-2 // Proc. Natl. Acad. Sci. USA. 2003. V.100. P.5028-5033. 952.
White R.R., Sullenger B.A., Rusconi C.P. Developing aptamers into therapeutics //
J. Clin. Invest. 2000. V.106. P.929–934. 953.
Wiegand T.W., Janssen R.C., Eaton B.E. Selection of RNA amide synthases //
Chem. Biol. 1997. V.4. P.675-683. 954.
Wiegand T.W., Williams P.B., Dreskin S.C., Jouvin M.H., Kinet J.P., Tasset D.
High-affinity oligonucleotide ligands to human IgE inhibit binding to Fcε receptor I // J. Immunol. 1996. V.157. P.221-230. 955.
Williams K.P., Bartel D.P. PCR product with strands of unequal length // Nucleic
Acids Res. 1995. V.23. P.4220-4221. 956.
Williams K.P., Ciafre S., Tocchini-Valentini G.P. Selection of novel Mg2+-
dependent self-cleaving ribozymes // EMBO J. 1995. V.14. P.4551-4557. 957.
Williams K.P., Liu X.H., Schumacher T.N., Lin H.Y., Ausiello D.A., Kim P.S.,
Bartel D.P. Bioactive and nuclease-resistant L-DNA ligand of vasopressin // Proc. Natl. Acad. Sci. USA. 1997. V.94. P.11285-11290. 958.
Willis M.C., Collins B.D., Zhang T., Green L.S., Sebesta D.P., Bell C., Kellogg
E., Gill S.C., Magallanez A., Knauer S., Bendele R.A., Gill P.S., Janjic N. Liposomeanchored vascular endothelial growth factor aptamers // Bioconjug. Chem. 1998. V.9. P.573-582.
155
959.
Wilson C., Nix J., Szostak J. Functional requirements for specific ligand
recognition by a biotin-binding RNA pseudoknot // Biochemistry. 1998. V.37. P.14410-14419. 960.
Wilson C., Szostak J.W. In vitro evolution of a self-alkylating ribozyme // Nature.
1995. V.374. P.777-782. 961.
Wilson C., Szostak J.W. Isolation of a fluorophore-specific DNA aptamer with
weak redox activity // Chem. Biol. 1998. V.5. P.609-617. 962.
3. Wilson D.S., Szostak J.W. In vitro selection of functional nucleic acids // Annu.
Rev. Biochem. 1999. V.68. P.611–647. 963.
Win M.N., Klein J.S., Smolke C.D. Codeine-binding RNA aptamers and rapid
determination of their binding constants using a direct coupling surface plasmon resonance assay // Nucleic Acids Research. 2006. V.34. P.5670-5682. 964.
Win M.N., Smolke C.D. A modular and extensible RNA-based gene-regulatory
platform for engineering cellular function // PNAS. 2007. V.104. P.14283-14288. 965.
Winkler W.C., Breaker R.R. Regulation of bacterial gene expression by
riboswitches // Annu. Rev. Microbiol. 2005. V.59. P.487–517. 966.
Winkler W.C., Breaker R.R. Genetic control by metabolite-binding riboswitches //
Chembiochem. 2003. V.4. P.1024–1032. 967.
Winkler W.C., Cohen-Chalamish S., Breaker R.R. An mRNA structure that
controls gene expression by binding FMN // Proc. Natl Acad. Sci. USA. 2002. V.99. P.15908–15913. 968.
Winkler W., Nahvi A., Breaker R.R. Thiamine derivatives bind messenger RNAs
directly to regulate bacterial gene expression // Nature. 2002. V.419. P.952–956. 969.
Winkler W.C., Nahvi A., Roth A., Collins J.A., Breaker R.R. Control of gene
expression by a natural metabolite-responsive ribozyme // Nature. 2004. V.428. P.281–286. 970.
Winkler W.C., Nahvi A., Sudarsan N., Barrick J.E., Breaker R.R. An mRNA
structure that controls gene expression by binding S-adenosylmethionine // Nat. Struct. Biol. 2003. V.10. P.701–707. 971.
Wlotzka B., Leva S., Eschgfaller B., Burmeister J., Kleinjung F., Kaduk C., Muhn
P., Hess-Stumpp H., Klussmann S. In vivo properties of an anti-GnRH Spiegelmer: an
156
example of an oligonucleotide-based therapeutic substance class // Proc. Natl. Acad. Sci. USA. 2002. V.99. P.8898-8902. 972.
Woese C.R., Winker S., Gutell R.R. // Proc. Natl. Acad. Sci. USA. 1990. V.87.
P.8467. 973.
Wright M.C., Joyce G.F. Continuous in vitro evolution of catalytic function //
Science. 1997. V.276. P.614-617. 974.
Wu H.N., Lin Y.J., Lin F.P., Makino S., Chang M.F., Lai M.M. Human hepatitis
delta virus RNA subfragments contain an autocleavage activity // Proc. Natl Acad. Sci. USA. 1989. V.86. P.1831–1835. 975.
Wu L.H., Curran J.F. An allosteric synthetic DNA // Nucleic Acids Res. 1999.
V.27. P.1512–1516. 976.
Wurster S.E., Maher III L.J. Selection and characterization of anti-NF-{kappa}B
p65 RNA aptamers // RNA. 2008. V.14. P.1037-1047. 977.
Xayaphoummine A., Viasnoff V., Harlepp S., Isambert H. Encoding folding paths
of RNA switches // Nucleic Acids Res. 2007. V.35. P.614-622. 978.
Xu W., Ellington A.D. Anti-peptide aptamers recognize amino acid sequence and
bind a protein epitope // Proc. Natl. Acad. Sci. USA. 1996. V.93. P.7475-7480. 979.
Xu X., Hamhouyia F., Thomas S.D., Burke T.J., Girvan A.C., McGregor W.G.,
Trent J.O., Miller D.M., Bates P.J. Inhibition of DNA Replication and Induction of S Phase Cell Cycle Arrest by G-rich Oligonucleotides // J. Biol. Chem. 2001. V.276. P.43221-43230. 980.
Yamamoto R., Katahira M., Nishikawa S., Baba T., Taira K., Kumar P.K. A novel
RNA motif that binds efficiently and specifically to the Tat protein of HIV and inhibits the trans-activation by Tat of transcription in vitro and in vivo // Genes Cells. 2000. V.5. P.371-388. 981.
Yamamoto-Fujita R., Kumar P.K.R. Aptamer-derived nucleic acid oligos:
applications to develop nucleic acid chips to analyze proteins and small ligands // Anal. Chem. 2005. V.77. P.5460–5466. 982.
Yang C.J., Jockusch S., Vicens M., Turro N.J., Tan W. Light-switching excimer
probes for rapid protein monitoring in complex biological fluids // PNAS. 2005. V.102. P.17278-17283.
157
983.
Yang C., Yan N., Parish J., Wang X., Shi Y., Xue D. RNA Aptamers Targeting the
Cell Death Inhibitor CED-9 Induce Cell Killing in Caenorhabditis elegans // J. Biol. Chem. 2006. V.281. P.9137-9144. 984.
Yang Q., Goldstein I.J., Mei H.Y., Engelke D.R. DNA ligands that bind tightly
and selectively to cellobiose // Proc. Natl Acad. Sci. USA. 1998. V.95. P.5462–5467. 985.
Yang W., Wang Q., Howell K.L., Lee J.T., Cho D.S., Murray J.M., Nishikura K.
ADAR1 RNA deaminase limits short interfering RNA efficacy in mammalian cells // J. Biol. Chem. 2005. V.280. P.3946–3953. 986.
Yang Y., Kochoyan M., Burgstaller P., Westhof E., Famulok M. Structural basis
of ligand discrimination by two related RNA aptamers resolved by NMR spectroscopy // Science. 1996. V.272. P.1343–1347. 987.
Yarus M. RNA-ligand chemistry: a testable source for the genetic code // RNA.
2000. V.6. P.475-484. 988.
Ye X., Gorin A., Ellington A.D., Patel D.J. Deep penetration of an alpha-helix into
a widened RNA major groove in the HIV-1 rev peptide-RNA aptamer complex // Nat. Struct. Biol. 1996. V.3. P.1026-1033. 989.
Ye X, et al. // Chem. Biol. 1999. V.6. P.657.
990.
Ye X., Kumar R.A., Patel D.J. // Chem. Biol. 1995. V.2. P.827.
991.
Yen L., Svendsen J., Lee J.S., Gray J.T., Magnier M., Baba T., D'Amato R.J.,
Mulligan R.C. Exogenous control of mammalian gene expression through modulation of RNA self-cleavage // Nature. 2004. V.431. P.471–476. 992.
Ylera F., Lurz R., Erdmann V.A., Furste J.P. Selection of RNA aptamers to the
Alzheimer's disease amyloid peptide // Biochem. Biophys. Res. Commun. 2002. V.290. P.1583-1588. 993.
Yoshizawa S., Fourmy D., Puglisi J.D. // EMBO J. 1998. V.17. P.6437.
994.
Zamore P.D., Haley B. Ribo-gnome: The big world of small RNAs // Science.
2005. V.309. P.1519–1524. 995.
Zhang B., Cech T.R. Peptide bond formation by in vitro selected ribozymes //
Nature. 1997. V.390. P.96-100. 996.
Zhang H., Kolb F.A., Jaskiewicz L., Westhof E., Filipowicz W. Single processing
center models for human Dicer and bacterial RNase III // Cell. 2004. V.118. P.57–68.
158
997.
Zhang L., Kasif S., Cantor A.C.R. Quantifying DNA-protein binding specificities
by using oligonucleotide mass tags and mass spectroscopy // PNAS. 2007. V.104. P.3061-3066. 998.
Zhang Q., Sun X., Watt E.D., Al-Hashimi H.M. Resolving the Motional Modes
That Code for RNA Adaptation // Science. 2006. V.311. P.653-656. 999.
Zhu L., Anslyn E.V. Signal amplification by allosteric catalysis // Angew. Chem.
Int. Ed. Engl. 2006. V.45. P.1190–1196. 1000. Zhuang X., Bartley L.E., Babcock H.P., Russell R., Ha T., Herschlag D., Chu S. A single-molecule study of RNA catalysis and folding // Science. 2000. V.288. P.2048– 2051. 1001. Zimmermann G.R., Jenison R.D., Wick C.L., Simorre J.P., Pardi A. Interlocking structural motifs mediate molecular discrimination by a theophylline-binding RNA // Nat. Struct. Biol. 1997. V.4. P.644–649. 1002. Zimmermann G.R., Shields T.P., Jenison R.D., Wick C.L., Pardi A. A semiconserved residue inhibits complex formation by stabilizing interactions in the free state of a theophylline-binding RNA // Biochemistry. 1998. V.37. P.9186-9192. 1003. Zimmermann G.R., Wick C.L., Shields T.P., Jenison R.D., Pardi A. Molecular interactions and metal binding in the theophylline-binding core of an RNA aptamer // RNA. 2000. V.6. P.659-667. 1004. Zivarts M., Liu Y., Breaker R.R. Engineered allosteric ribozymes that respond to specific divalent metal ions // Nucleic Acids Res. 2005. V.33. P.622-631. 1005. Zuker M. Mfold web server for nucleic acid folding and hybridization prediction // Nucleic Acids Res. 2003. V.31. P.3406–3415. 1006. Zuker M. Computer prediction of RNA structure // Methods Enzymol. 1989. V.183. P.202–287. 1007. http://aptamer.icmb.utexas.edu/ 1008. Prusiner S.B. Novel proteinaceous infectious particles cause scrapie // Science. 1982. V.216. P.136–144. 1009. Pan K.M., Baldwin M., Nguyen J., Gasset M., Serban A., Groth D., Mehlhorn I., Huang Z., Fletterick R.J., Cohen F.E. Conversion of alpha-helices into beta-sheets
159
features in the formation of the scrapie prion proteins // Proc. Natl. Acad. Sci. USA. 1993. V.90. P.10962–10966. 1010. Huang Z., Gabriel J.M., Baldwin M.A., Fletterick R.J., Prusiner S.B., Cohen F.E. Proposed three-dimensional structure for the cellular prion protein // Proc. Natl. Acad. Sci. USA. 1994. V.91. P.7139–7143. 1011. Cohen F.E., Pan K.M., Huang Z., Baldwin M., Fletterick R.J., Prusiner S.B. Structural clues to prion replication // Science. 1994. V.264. P.530–531. 1012. Scott M., Foster D., Mirenda C., Serban D., Coufal F., Walchli M., Torchia M., Groth D., Carlson G., DeArmond S.J. Transgenic mice expressing hamster prion protein produce species-specific scrapie infectivity and amyloid plaques // Cell. 1989. V.59. P.847–857. 1013. Saborio G.P., Permanne B., Soto C. Sensitive detection of pathological prion protein by cyclic amplification of protein misfolding // Nature. 2001. V.411. P.810– 813. 1014. Castilla J., Saa P., Hetz C., Soto C. In vitro generation of infectious scrapie prions // Cell. 2005. V.121. P.195–206. 1015. Gajdusek D.C. The transmissible amyloidoses: genetical control of spontaneous generation of infectious amyloid proteins by nucleation of configurational change in host precursors: kuru-CJD-GSS-scrapie-BSE // Eur. J. Epidemiol. 1991. V.5. P.567– 577. 1016. Prusiner S.B., McKinley M.P., Groth D.F., Bowman K.A., Mock N.I., Cochran S.P., Masiarz F.R. Scrapie agent contains a hydrophobic protein // Proc. Natl. Acad. Sci. USA. 1981. V.78. P.6675–6679. 1017. McKinley M.P., Bolton D.C., Prusiner S.B. A protease-resistant protein is a structural component of the scrapie prion // Cell. 1983. V.35. P.57–62. 1018. Bolton D.C., McKinley M.P., Prusiner S.B. Identification of a protein that purifies with the scrapie prion // Science. 1982. V.218. P.1309–1311. 1019. Yokoyama T., Kimura K.M., Ushiki Y., Yamada S., Morooka A., Nakashiba T., Sassa T.,
Itohara S. In vivo conversion of cellular prion protein to pathogenic
isoforms, as monitored by conformation-specific antibodies // J. Biol. Chem. 2001. V.276. P.11265–11271.
160
1020. Winkler W., Nahvi A., Breaker R.R. Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression // Nature. 2002. V.419. P.952–956. 1021. Filipowicz W., Jaskiewicz L., Kolb F.A., Pillai R.S. Post-transcriptional gene silencing by siRNAs and miRNAs // Curr. Opin. Struct. Biol. 2005. V.15. P.331–341. 1022. Okazaki Y., Furuno M., Kasukawa T., Adachi J., Bono H., Kondo S., Nikaido I., Osato N., Saito R., Suzuki H., et al. Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs // Nature. 2002. V.420. P.563–573. 1023. Numata K., Kanai A., Saito R., Kondo S., Adachi J., Wilming L.G., Hume D.A., Hayashizaki Y., Tomita M. Identification of putative noncoding RNAs among the RIKEN mouse full-length cDNA collection // Genome Res. 2003. V.13. P.1301–1306. 1024. Huttenhofer A., Kiefmann M., Meier-Ewert S., O'Brien J., Lehrach H., Bachellerie J.P., Brosius J. RNomics: an experimental approach that identifies 201 candidates for novel, small, non-messenger RNAs in mouse // EMBO J. 2001. V.20. P.2943–2953. 1025. Wassarman K.M., Repoila F., Rosenow C., Storz G., Gottesman S. Identification of novel small RNAs using comparative genomics and microarrays // Genes Dev. 2001. V.15. P.1637–1651. 1026. Yuan G.Z., Klambt C., Bachellerie J.P., Brosius J., Huttenhofer A. RNomics in Drosophila melanogaster: identification of 66 candidates for novel non-messenger RNAs // Nucleic Acids Res. 2003. V.31. P.2495–2507. 1027. Eddy S.R. Computational Genomics of noncoding RNA genes // Cell. 2002. V.109. P.137–140. 1028. Rivas E., Klein R.J., Jones T.A., Eddy S.R. Computational identification of noncoding RNAs in E-coli by comparative genomics // Curr. Biol. 2001. V.11. P.1369–1373. 1029. Carter R.J., Dubchak I., Holbrook S.R. A computational approach to identify genes for functional RNAs in genomic sequences // Nucleic Acids Res. 2001. V.29. P.3928–3938. 1030. Kim N., Shiffeldrim N., Gan H.H., Schlick T. Candidates for novel RNA topologies // J. Mol. Biol. 2004. V.341. P.1129–1144.
161
1031. Gan H.H., Pasquali S., Schlick T. Exploring the repertoire of RNA secondary motifs using graph theory; implications for RNA design // Nucleic Acids Res. 2003. V.31. P.2926–2943. 1032. Lim L.P., Lau N.C., Weinstein E.G., Abdelhakim A., Yekta S., Rhoades M.W., Burge C.B., Bartel D.P. The microRNAs of Caenorhabditis elegans // Genes Dev. 2003. V.17. P.991–1008. 1033. Macke T.J., Ecker D.J., Gutell R.R., Gautheret D., Case D.A., Sampath R. RNAMotif, an RNA secondary structure definition and search algorithm // Nucleic Acids Res. 2001. V.29. P.4724–4735. 1034. Hofacker I.L. Vienna RNA secondary structure server // Nucleic Acids Res. 2003. V.31. P.3429–3431. 1035. Rangan P., Masquida B., Westhof E., Woodson S.A. Assembly of core helices and rapid tertiary folding of a small bacterial group I ribozyme // Proc. Natl. Acad. Sci. USA. 2003. V.100. P.1574–1579. 1036. Kitagawa J., Futamura Y., Yamamoto K. Analysis of the conformational energy landscape of human snRNA with a metric based on tree representation of RNA structures // Nucleic Acids Res. 2003. V.31. P.2006–2013. 1037. Reinert G., Schbath S., Waterman M.S. Probabilistic and statistical properties of words: an overview // J. Comput. Biol. 2000. V.7. P.1–46. 1038. Durbin R., Eddy S., Krogh A., Mitchison G. Biological Sequence Analysis Probabilistic Models of Proteins and Nucleic Acids, Cambridge, UK Cambridge University Press, 1998. 1039. Rivas E., Eddy S.R. Secondary structure alone is generally not statistically significant for the detection of noncoding RNAs // Bioinformatics. 2000. V.16. P.583– 605. 1040. Keiper S., Bebenroth D., Seelig B., Westhof E., Jäschke A. Architecture of a Diels-Alderase ribozyme with a preformed catalytic pocket // Chem. Biol. 2004. V.11. P.1217–1227. 1041. Seelig B., Jäschke A. A small catalytic RNA motif with Diels-Alderase activity // Chem. Biol. 1999. V.6. P.167–176.
162
1042. Seelig B., Keiper S., Stuhlmann F., Jäschke A. Enantioselective ribozyme catalysis of a bimolecular cycloaddition reaction // Angew. Chem. Int. Ed. Engl. 2000. V.39. P.4576–4579. 1043. Serganov A., Keiper S., Malinina L., Tereshko V., Skripkin E., Höbartner C., Polonskaia A., Phan A.T., Wombacher R., Micura R., et al. Structural basis for DielsAlder ribozyme-catalyzed carbon-carbon bond formation // Nature Struct. Mol. Biol. 2005. V.12. P.218–224. 1044. Stuhlmann F., Jäschke A. Characterization of an RNA active site: interactions between a Diels-Alderase ribozyme and its substrates and products // J. Am. Chem. Soc. 2002. V.124. P.3238–3244. 1045. Wombacher R., Keiper S., Suhm S., Serganov A., Patel D.J., Jäschke A. Control of stereoselectivity in an enzymatic reaction by backdoor access // Angew. Chem. Int. Ed. Engl. 2006. V.45. P.2469–2472. 1046. Duckett D., Lilley D.M.J. // EMBO J. 1990. V.9. P.1659–1664. 1047. Guo Q., Lu M., Churchill M.E.A., Kallenbach N.R. // Biochemistry. 1990. V.29. P.10927–10934. 1048. Lu M., Guo Q., Kallenbach N.R. // Biochemistry. 1991. V.30. P.5815–5820. 1049. Stühmeier F., Welch J.B., Murchie A.I.H., Lilley D.M.J., Clegg R.M. // Biochemistry. 1997. V.36. P.13530–13538. 1050. Shlyakhtenko L.S., Potaman V.N., Sinden R.R., Gall A.A., Lyubchenko Y.L. Structure and dynamics of three-way DNA junctions: atomic force microscopy studies // Nucleic Acids Res. 2000. V.28. P.3472-3477. 1051. Orr-Weaver T.L., Szostak J.W., Rothstein R.J. // Proc. Natl Acad. Sci. USA. 1981. V.78. P.6354–6358. 1052. Minagawa T., Murakami A., Ryo Y., Yamagishi H. // Virology. 1983. V.126. P.183–193. 1053. Guo Q., Seeman N.C., Kallenbach N.R. // Biochemistry. 1989. V.28. P.2355– 2359. 1054. Guo Q., Seeman N.C., Kallenbach N.R. // Biochemistry. 1990. V.29. P.3407– 3412.
163
1055. Rimmer J.J., Hinde C.J. Acceptance of Context Sensitive Languages Using Ribonucleic Acid Computation // Boris Mirkin and George Magoulas, Eds. Proceedings of the 2005 UK Workshop on Computational Intelligence. London, UK, 5-7 September 2005. Birkbeck University of London, 2005. P.289-294. 1056. Winfree E. Whiplash pcr for o(1) computing // Technical Report 1998.23, Caltech, 1998. 1057. Hagiya M., Arita M., Kiga D., Sakamoto K., Yokoyama S. // H. Rubin and D. H Woods, editors. DNA Based Computers III. American Mathematical Society, 1999. P.55-72. 1058. Sakamoto K., Kiga D., Komiya K., Gouzu H., Yokoyama S., Ikeda S., Sugiyama H., Hagiya M. State transitions by molecules // Biosystems. 1999. V.52. P.81–91. 1059. Nishikawa A., Hagiya M. Towards a system for simulating DNA computing with whiplash PCR // P.J.Angeline, Z.Michalewicz, M.Schoenauer, X.Yao, A.Zalzala, editors. Proceedings of the Congress on Evolutionary Computation. V.2. Mayflower Hotel,Washington D.C., USA, 6-9 1999. IEEE Press, 1999. P.960-966. 1060. Rose J.A., Deaton R.J., Hagiya M., Suyama A. Pna-mediated whiplash pcr // Lecture Notes In Computer Science 2340. 2001. P.104 – 116. 1061. Matsuda D., Yamamura M. Cascading whiplash pcr with a nicking enzyme // Lecture Notes In Computer Science 2568. 2002. P.38 – 46. 1062. Reif J.H., Majumder U. Isothermal Reactivating Whiplash PCR for Locally Programmable Molecular Computation, Fourteenth International Meeting on DNA Based Computers (DNA14), Prague, Czech Republic (June, 2008). To appear in Lecture Notes for Computer Science (LNCS), NYC, NY, (edited by Ashish Goel and Friedrich C. Simmel), Springer-Verlag, New York, (2009). Электронный вариант доступен
по
адресу:
http://www.cs.duke.edu/~reif/paper/urmi/whipPCR/whipPCR.pub.pdf. 1063. Wang H. Dominoes and the AEA Case of the Decision Problem // J. Fox, Eds. Mathematical Theory of Automata. Brooklyn, N.Y., Polytechnic Press, 1963. P.23-55. 1064. Seeman N.C. Nucleicacid junctions and lattices // Journal of Theoretical Biology. 1982. V.2. P.237-247.
164
1065. Winfree E. On the computational power of DNA annealing and ligation // Lipton E.J., Baum E.B., Eds. DNA Based Computing. Providence: Am. Math. Soc., 1996. P.199-219. 1066. Winfree E., Liu F., Wenzler L.A., Seeman N.C. Design and selfassembly of twodimensional DNA crystals // Nature. 1998. V.394. P.539-544. 1067. LaBean T.H., Winfree E., Reif J.H. Experimental Progress in Computation by Self-Assembly of DNA Tilings // DIMACS Series in Discrete Mathematics and Theoretical Computer Science. 2000. V.54. P.123-140. 1068. Rothemund P., Winfree E. The programsize complexity of selfassembled squares // F. F. Yao, editor. Proceedings of the 32nd Annual ACM Symposium on Theory of Computing. Portland, OR, 21--23 May 2000. 1069. Winfree E., Eng T., Rozenberg G. String tile models for DNA computing by selfassembly // A. Condon, G. Rozenberg, editors. DNA Based Computers VI. Leiden, The Netherlands, 13--17 June 2000. 1070. Kao M., Ramachandran V. DNA Self-Assembly for Constructing 3D Boxes // Proc. ISAAC 2001, LNCS 2223. 2001. P.429-440. 1071. Mao C., Sun W., Shen Z., Seeman N. A DNA nanomechanical device based on the B-Z transition // Nature. 1999. V.397. P.144-146. 1072. Tian Y., Mao C. Molecular gears: A pair of DNA circles continously rolls against each other // J. Am. Chem. Soc. 2004. V.126. P.11410-11411. 1073. Yan H., Zhang X., Shen Z., Seeman N. A robust DNA mechanical device controlled by hybridization topology // Nature. 2002. V.415. P.62-65. 1074. Simmel F., Yurke B. Using DNA to construct and power a nanoactuator // Phys. Rev. E. 2001. V.63. P.41913. 1075. Simmel F., Yurke B. A DNA-based molecular device switchable between three distinct mechanical states // Appl. Phys. Lett. 2002. V.80. P.883-885. 1076. Yurke B., Turberfield A., Mills J.A.P., Simmel F., Neumann J. A DNA-fuelled molecu-lar machine made of DNA // Nature. 2000. V.406. P.605-608. 1077. Alberti P., Mergny J. DNA duplex-quadruplex exchange as the basis for a nanomolecular machine // Proc. Natl. Acad. Sci. USA. 2003. V.100. P.1569-1573.
165
1078. Feng L., Park S., Reif J., Yan H. A two-state DNA lattice switched by DNA nanoactuator // Angew. Chem. Int. Ed. 2003. V.42. P.4342-4346. 1079. Li J., Tan W. A single DNA molecule nanomotor // Nano Lett. 2002. V.2. P.315318. 1080. Sherman W., Seeman N. A precisely controlled DNA biped walking device // Nano Lett. 2004. V.4. P.1203-1207. 1081. Shin J., Pierce N. A synthetic DNA walker for molecular transport // J. Am. Chem. Soc. 2004. V.126. P.10834-10835. 1082. Reif J.H. The Design of Autonomous DNA Nanomechanical Devices: Walking and Rolling DNA // DNA Based Computers, Sapporo, Japan. Edited by Masami Hagiya and Azuma Ohuchi. LNCS. 2003. V.2568. P.22-37. 1083. Yin P., Turberfield A.J., Sahu S., Reif J.H. Designs for Autonomous Unidirectional Walking DNA Devices // Tenth International Meeting on DNA Based Computers, Milano, Italy. Edited by C Ferretti, G. Mauri and C. Zandron. LNCS. 2005. V.3384. P.410-425. 1084. Yin P., Yan H., Daniel X.G., Turberfield A.J., Reif J.H. A Unidirectional DNA Walker Moving Autonomously Along a Linear Track // Angewandte Chemie. 2004. V.43. N.37. P.4906-4911. 1085. Chen Y., Wang M., Mao C. An autonomous DNA motor powered by a DNA enzyme // Angew. Int. Ed. 2004. V.43. P.2-5. 1086. Sherman W.B., Seeman N.C. A precisely controlled DNA biped walking device // Nano. Lett. 2004. V.4. P.1203-1207. 1087. Turberfield A., Mitchell J., Yurke B., Mills J.A.P., Blakey M., Simmel F. DNA fuel for free-running nanomachines // Phys. Rev. Lett. 2003. V.90. P.118102. 1088. Barish R.D., Rothemund P.W.K., Winfree E. Two Computational Primitives for Algorithmic Self-Assembly: Copying and Counting // NanoLetters. 2005. V.5. P.2586-2592. 1089. Mao C., LaBean T.H., Reif J.H., Seeman N.C. Logical Computation Using Algorithmic Self-Assembly of DNA Triple Crossover Molecules // Nature. 2000. V.407. P.493-496.
166
1090. Mao C., LaBean T.H., Reif J.H., Seeman N.C. Erratum // Nature. 2000. V.408. P.750. 1091. Rothemund P.W.K., Papadakis N., Winfree E. Algorithmic Self-Assembly of DNA Sierpinski Triangles // PLoS Biology. 2004. V.2. 1092. Yan H., Feng L., LaBean T.H., Reif J. DNA Nanotubes, Parallel Molecular Computations of Pairwise Exclusive-Or (XOR) Using DNA "String Tile" SelfAssembly // Journal of American Chemistry Society(JACS). 2003. V.125. P.1424614247. 1093. Carbone A., Seeman N.C. Circuits and Programmable Self-Assembling DNA Structures // Proc. Nat. Acad. Sci. USA. 2002. V.99. P.12577-12582. 1094. Reif J., Sahu S. Autonomous Programmable DNA Nanorobotic Devices Using DNAzymes // 13th International Meeting on DNA Computing (DNA 13), Memphis, Tennessee, June 4-8, 2007. P.1–16. 1095. Yin P., Turberfield A., Sahu S., Reif J. Design of an autonomous DNA nanomechanical device capable of universal computation and universal translational motion // Tenth International Meeting on DNA Computing. LNCS. 2005. V.3384. P.426--444. 1096. Dirks R.M., Pierce N.A. Triggered amplification by hybridization chain reaction // PNAS. 2004. V.101. P.15275-15278. 1097. Cavalcanti A. Assembly Automation with Evolutionary Nanorobots and SensorBased Control applied to Nanomedicine // IEEE Transactions on Nanotechnology. 2003. V. 2. P.82-87. 1098. Vriezema D.M. et al. Self-assembled nanoreactors // Chem. Rev. 2005. V.105. P.1445–1489. 1099. Douglas T. et al. Synthesis and structure of an iron(III) sulfide–ferritin bioinorganic nanocomposite // Science. 1995. V.269. P.54–57. 1100. Meldrum F.C., Heywood B.R., Mann S. Magnetoferritin—in vitro synthesis of a novel magnetic protein // Science. 1992. V.257. P.522–523. 1101. Ueno T. et al. Size-selective olefin hydrogenation by a Pd nanocluster provided in an apoferritin cage // Angew. Chem. Int. Edn. 2004. V.43. P.2527–2530.
167
1102. Seebeck F.P., Woycechowsky K.J., Zhuang W., Rabe J.P., Hilvert D. A simple tagging system for protein encapsulation // J. Am. Chem. Soc. 2006. V.128. P.4516– 4517. 1103. Varpness Z., Peters J.W., Young M., Douglas T. Biomimetic synthesis of an H2 catalyst using a protein cage architecture // Nano Lett. 2005. V.5. P.2306–2309. 1104. Douglas T., Young M. Host–guest encapsulation of materials by assembled virus protein cages // Nature. 1998. V.393. P.152–155. 1105. Douglas T. et al. Protein engineering of a viral cage for constrained nanomaterials synthesis // Adv. Mater. 2002. V.14. P.415–418. 1106. Douglas T., Young M. Viruses: Making friends with old foes // Science. 2006. V.312. P.873–875. 1107. Flynn C.E., Lee S.-W., Peelle B.R., Belcher A.M. Viruses as vehicles for growth, organization and assembly of materials // Acta Mater. 2003. V.51. P.5867–5880. 1108. Shenton W., Douglas T., Young M., Stubbs G., Mann S. Inorganic–organic nanotube composites from template mineralization of tobacco mosaic virus // Adv. Mater. 1999. V.11. P.253–256. 1109. Dujardin E., Peet C., Stubbs G., Culver J.N., Mann S. Organization of metallic nanoparticles using tobacco mosaic virus templates // Nano Lett. 2003. V.3. P.413– 417. 1110. Mao C.B. et al. Virus-based toolkit for the directed synthesis of magnetic and semiconducting nanowires // Science. 2004. V.303. P.213–217. 1111. Carette N. et al. A virus-based biocatalyst // Nature Nanotech. 2007. V.2. P.226– 229. 1112. Arora P.S., Kirshenbaum K. Nano-tailoring: Stitching alterations on viral coats // Chem. Biol. 2004. V.11. P.418–420. 1113. Wang Q. et al. Bioconjugation by copper(I)-catalyzed azide-alkyne 3 ю 2 cycloaddition // J. Am. Chem. Soc. 2003. V.125. P.3192–3193. 1114. Hooker J.M., Kovacs E.W., Francis M.B. Interior surface modification of bacteriophage MS2 // J. Am. Chem. Soc. 2004. V.126. P.3718–3719. 1115. Comellas-Aragone M., Engelkamp H., Claessen V.I., Sommerdijk N.A.J.M., Rowan A.E., Christianen P.C.M., Maan J.C., Verduin B.J.M., Cornelissen J.J.L.M.,
168
Nolte R.J.M. A virus-based single-enzyme nanoreactor // Nature nanotechnology. 2007. V.2. P.635-639. 1116. Venkataraman S., Dirks R.M., Rothemund P.W.K., Winfree E., Pierce N.A. An autonomous polymerization motor powered by DNA hybridization // Nature Nanotechnology. 2007. V.2. P.490-494. 1117. Wang Y., Muller J.E., Kemper B., Seeman N.C. The assembly and characterization of 5-arm and 6-arm DNA branched junctions // Biochemistry. 1991. V.30. P.5667-5674. 1118. LaBen T.H., Yan H., Kopatsch J., Liu F., Winfree E., Reif J.H, Seeman N.C. The Construction of DNA Triple Crossover Molecules // Journal of the American Chemical Society. 2000. V.122. P.1848-1860. 1119. Park S.H., Pistol C., Ahn S.J., Reif J.H., Lebeck A.R., Dwyer C., LaBean T.H. Finite-size, fully addressable dna tile lattices formed by hierarchical assembly procedures // Angew. Chem. Int. Ed. 2006. V.45. P.735-739. 1120. Chen J., Seeman N.C. The electrophoretic properties of a DNA cube and its substructure catenanes // Electrophoresis. 1991. V.12. P.607-611. 1121. Ajo-Franklin C.M., Drubin D.A., Eskin J.A., Gee E.P.S., Landgraf D., Phillips I., Silver P.A. Rational design of memory in eukaryotic cells // Genes & Dev. 2007. V.21. P.2271-2276. 1122. Anantharam A., Markowitz S.M., Abbott G.W. Pharmacogenetic considerations in diseases of cardiac ion channels // J. Pharmacol. Exp. Ther. 20003. V.307. P.831–838. 1123. Anderson J.C., Clarke E.J., Arkin A.P., Voigt C.A. Environmentally controlled invasion of cancer cells by engineered bacteria // J. Mol. Biol. 2006. V.355. P.619– 627. 1124. Andrianantoandro E., Basu S., Karig D.K., Weiss R. Synthetic biology: New engineering rules for an emerging discipline // Mol. Syst. Biol. 2006. V.22006.0028. 1125. Arkin A.P. Synthetic cell biology // Curr. Opin. Biotechnol. 2001. V.12. P.638– 644. 1126. Arkin A.P., Fletcher D.A. Fast, cheap and somewhat in control // Genome Biol. 2006. V.7. P.114.
169
1127. Atkinson M.R., et al. Development of genetic circuit exhibiting toggle switch or oscillatory behavior in. Escherichia Coli // Cell. 2003. V.113. P.597–607. 1128. Atsumi S., Little J.W. Regulatory circuit design and evolution using phage
//
Genes & Dev. 2004. V.18. P.2086–2094. 1129. Babu M.M., Teichmann S.A. Evolution of transcription factors and the gene regulatory network in Escherichia coli // Nucleic Acids Res. 2003. V.31. P.1234– 1244. 1130. Basu S., Mehreja R., Thiberge S., Chen M.T., Weiss R. Spatiotemporal control of gene expression with pulse-generating networks // Proc. Natl. Acad. Sci. 2004. V.101. P.6355–6360. 1131. Basu S., Gerchman Y., Collins C.H., Arnold F.H., Weiss R. A synthetic multicellular system for programmed pattern formation // Nature. 2005. V.434. P.1130–1134. 1132. Bayer T.S., Smolke C.D. Programmable ligand-controlled riboregulators of eukaryotic gene expression // Nat. Biotechnol. 2005. V.23. P.337–343. 1133. Becskei A., Serrano L. Engineering stability in gene networks by autoregulation // Nature. 2000. V.405. P.590–593. 1134. Becskei A., Seraphin B., Serrano L. Positive feedback in eukaryotic gene networks: Cell differentiation by graded to binary response conversion // EMBO J. 2001. V.20. P.2528–2535. 1135. Benner S.A. Synthetic biology: Act natural // Nature. 2003. V.421. P.118. 1136. Benner S.A., Sismour A.M. Synthetic biology // Nat. Rev. Genet. 2005. V.6. P.533–543. 1137. Beyer P., Al-Babili S., Ye X., Lucca P., Schaub P., Welsch R., Potrykus I. Golden Rice: Introducing the -carotene biosynthesis pathway into rice endosperm by genetic engineering to defeat vitamin A deficiency // J. Nutr. 2002. V.132. P.506S–510S. 1138. Bhattacharyya R.P., Remenyi A., Yeh B.J., Lim W.A. Domains, motifs, and scaffolds: The role of modular interactions in the evolution and wiring of cell signaling circuits // Annu. Rev. Biochem. 2006. V.75. P.655–680. 1139. Bintu L., et al. Transcriptional regulation by the numbers: applications // Curr. Opin. Genet. & Dev. 2005. V.15. P.125–135.
170
1140. Cello J., Paul A.V., Wimmer E. Chemical synthesis of poliovirus cDNA: Generation of infectious virus in the absence of natural template // Science. 2002. V.297. P.1016–1018. 1141. Chin J.W. Programming and engineering biological networks // Curr. Opin. Struct. Biol. 2006. V.16. P.551–556. 1142. Elowitz M.B., Leibler S. A synthetic oscillatory network of transcriptional regulators // Nature. 2000. V.403. P.335–338. 1143. Elowitz M.B., Levine A.J., Siggia E.D., Swain P.S. Stochastic gene expression in a single cell // Science. 2002. V.297. P.1183–1186. 1144. Endy D. Foundations for engineering biology // Nature. 2005. V.438. P.449–453. 1145. Feng X.J., et al. Optimizing genetic circuits by global sensitivity analysis // Biophys. J. 2004. V.87. P.2195–2202. 1146. Kolisnychenko V., Plunkett III G., Herring C.D., Feher T., Posfai J., Blattner F.R., Posfai G. Engineering a reduced Escherichia coli genome // Genome Res. 2002. V.12. P.640–647. 1147. Marchisio M.A., Stelling J. Computational design of synthetic gene circuits with composable parts // Bioinformatics. 2008. V.24. P.1903-1910. 1148. Morimoto T., Kadoya R., Endo K., Tohata M., Sawada K., Liu S., Ozawa T., Kodama T.,
Kakeshita H., Kageyama Y., et al. Enhanced Recombinant Protein
Productivity by Genome Reduction in Bacillus subtilis // DNA Res. 2008. V.15. P.7381. 1149. Seet B.T., Dikic I., Zhou M.M., Pawson T. Reading protein modifications with interaction domains // Nat. Rev. Mol. Cell Biol. 2006. V.7. P.473–483. 1150. Chen L., Aihara K. A model of periodic oscillation for genetic regulatory systems // IEEE Trans. Circuits Syst. I. 2002. V.49. P.1429-1436. 1151. Chen L., Wang R., Kobayashi T., Aihara K. Dynamics of gene regulatory networks with cell division cycles // Phys. Rev. E. 2004. V.70. P.1-13. 1152. Crosthwaite S.K., Dunlap J.C., Loros J.J. Neurospora wc-1 and wc-2: transcription, photoresponses, and the origin of circadian rhythmicity // Science. 1997. V.276. P.763-769. 1153. Dunlap J.C. Molecular bases for circadian clocks // Cell. 1999. V.96. P.271-290.
171
1154. Leloup J., Gonze D., Goldbeter A. Limit cycle models for circadian rhythms based on transcription regulation in Drosophila and Neurospora // J. Biol. Rhythms. 1999. V.19. P.10-21. 1155. Belair J., Campbell S.A., Driessche P. Frustration, stability, and delay-induced oscillations in a neural network model // SIAM J. Appl. Math. 1996. V.56. P.245-255. 1156. Deng Y., Ding M., Feng J. Synchronization in stochastic coupled systems: theoretical results // J. Phys. A: Math. Gen. 2004. V.37. P.2163-2173. 1157. Elowitz M.B., Leibler S. Asynthetic oscillatory network of transcriptional regulators // Nature. 2000. V.403. P.335-338. 1158. Garcia-Ojalvo J., Elowitz M., Strogatz S.H. Modeling a synthetic multicellular clock: repressilators coupled by quorum sensing // PNAS. 2004. V.101. P.1095510960. 1159. Goldbeter A. Amodel for circadian oscillations in the Drosophila period protein (PER) // Proc. R. Soc. Lond. B. 1995. V.261. P.319-324. 1160. Golden S.S., Ishiura M., Johnson C.H., Kondo T. Cyanobacterial circadian rhythms // Annu. Rev. Plant. Physiol. Plant. Mol. Biol. 1997. V.48. P.327-354. 1161. Kunz H., Achermann P. Simulation of circadian rhythm generation in the suprachiasmatic nucleus with locally coupled self-sustained oscillators // J. Theor. Biol. 2003. V.224. P.63-78. 1162. Malpel S., Klarsfeld A., Rouyer F. Circadian synchronization and rhythmicity in larval photoperceptiondefective mutation of Drosophila // J. Biol. Rhythms. 2004. V.19. P.10-21. 1163. McMillen D., Kopell N., Hasty J., Collins J.J. Synchronizing genetic relaxation oscillators by intercell signaling // PNAS. 2002. V.99. P.679-684. 1164. Pecora L.M., Carrol T.L. Master stability functions for synchronized coupled systems // Phys. Rev. Lett. 1998. V.80. P.2105-2109. 1165. Pikovsky A., Rosenblum M., Kurths J. Synchronization: AUniversal Concept in Nonlinear Sciences. Cambridge, UK: Cambridge University Press, 2001. 1166. Taga M.E., Bassler B.L. Chemical communication among bacteria // PNAS. 2003. V.100. P.14549-14554.
172
1167. Ueda H., Hirose K., Iino M. Intercellular coupling mechanism for synchronized and noise-resistant circadian oscillators // J. Theor. Biol. 2002. V.216. P.501-512. 1168. Wang R., Chen L. Synchronizing Genetic Oscillators by Signaling Molecules // J. Biol. Rhythms. 2005. V.20. P.257-269. 1169. Wang R., Jing Z., Chen L. Modelling periodic oscillation in gene regulatory networks by cyclic feedback networks // Bull. Math. Biol. 2004. V.67. P.339-367. 1170. Wang R., Zhou T., Jing Z., Chen L. Modelling periodic oscillation of biological systems with multiple time scale networks // Syst. Biol. 2004. V.1. P.71-84. 1171. Winfree A.T. The Geometry of Biological Time. Berlin: Springer-Verlag, 2000. 1172. Weiss R., Knight T.F. Engineering communications for microbial robotics // DNA6. 2000. 1173. Heinlein M. Plasmodesmata: dynamic regulation and role in macromolecular cellto-cell signaling // Curr. Opin. Plant. Biol. 2002. V.5. P.543-552. 1174. Perbal B. Communication is the key // Cell Commun. Signaling. 2003. V.1. P.1-4. 1175. Chen L.,Wang R., Zhou T., Aihara K. Noise-induced cooperative behavior in a multi-cell system // Proceedings of IEEE International Symposium on Circuits and Systems. 2005.
173
5. Наноинформатика Развитие бионанотехнологий ставит перед компьютерными науками широкий спектр новых задач. Это моделирование наноустройств и их отдельных узлов на этапе разработки, симуляция работы наноустройств, управление наносистемами и т.д. Существенное внимание уделяется исследованиям, направленным на создание алгоритмов, моделей и симуляторов для разработки наноустройств на биохимическим уровне. На сегодняшний день разработано несколько симуляторов для биохимических реакций (см. [1] – [6]). В работах [7], [8] предложены алгоритмы анализа некоторых аспектов взаимодействия молекул ДНК. В [9] – [12] описан ряд подходов к моделированию поведения одиночной последовательности ДНК на основе метода Монте-Карло. Методы моделирования РНК рассматривались в работах [13] – [15]. В [16] – [23] разработаны алгоритмы вычисления концентрации молекул ДНК в зависимости от возможных реакций. Большое внимание уделяется исследованию различных моделей полимеризации ДНК [24] – [47]. В работах [48] – [54] исследуются вопросы моделирования ДНК на основе броуновской динамики. Рассматривался также вопрос о моделировании событий: гибридизации, дегибридизации, перемещения [55]. На основе анализа молекулярной коммуникации естественных молекулярных систем (см. [56] – [58]) разрабатываются модели молекулярной коммуникации для искусственных молекулярных систем и наноустройств (см. [59] – [62]). Весьма
важным
представляется
рассмотрение
вопросов
разработки,
моделирования и управления на уровне, абстрагирующемся от биохимической природы явлений, поскольку это позволяет оперировать общими понятиями для ДНК наномеханических устройств и обычных механических роботов. Это позволяет привлечь
для
разработки
наномеханических
устройств
модели
классической
робототехники. При этом следует отметить, что в отдельных случаях возможен полный перенос существующих робототехнических моделей на наноуровень, а в некоторых случаях необходима существенная ревизия, добавляющая в модели принципиально новые краски. Не ставя перед собой задачу дать полный анализ применимости существующих робототехнических теорий к наномеханическим устройствам, мы остановимся лишь на нескольких концепциях с акцентом на различия между
174
макроуровнем и наноуровнем. В частности, для разработки систем управления и коммуникации для наномеханических устройств представляют существенный интерес соответствующие модели теории искусственного интеллекта, относящиеся к называемому Bottom – Up AI.
так
В первую очередь к числу таких моделей следует
отнести
модели искусственного интеллекта на основе локальных предпочтений (см. [63] – [68]);
системы
реактивного
управления,
применяемые
для
разработки
архитектуры автономных систем роботов, функционирующих под контролем распределенных систем управления (см. [69] – [79]);
теория возникновения и эволюции языка и сознания как единой адаптивной динамической системы (см. [80] – [83]);
теория самоорганизующихся языков (см. [84] – [89]);
исследования
в
области
ассоциации
символьной
и
аналоговой
информации (см. [90] – [98]);
теория возникновения предпочтений и функциональности (см. [99] – [108]);
теория автономности и автономных агентов (см. [109] – [114]).
Раздел искусственного интеллекта направленности
совпадает
с
Bottom – Up AI по своей идейной
нанотехнологиями,
поскольку
в
обоих
случаях
распространение управления предполагается снизу вверх. Однако перенос моделей Bottom – Up AI на системы наномеханических роботов сопряжен с довольно серьезными трудностями. Основная трудность заключается в том, что формирование новых знаний и/или адаптация имеющихся приведет к изменению физических параметров наномеханических устройств: если изменение содержимого карты памяти обычного робота на может существенно повлиять на механические характеристики устройства, то в случае наномеханического робота произойдет изменение атомномолекулярной структуры, с которым желательно считаться. Другая важная проблема связана с тем, что генетический материал весьма подвержен точечным мутациям. Соответственно невозможно построить эффективную систему управления ДНК наномеханическим роботом, исходя из предположения, что самопроизвольное
175
изменение структуры робота – поломка. Еще одна проблема заключается в том, что искусственно синтезированная ДНК, попадая в живую клетку, рассматривается клеткой как ДНК (что неудивительно…) и как следствие может быть подвергнута процедуре копирования. Соответственно системы управления, разрабатываемые для ДНК наномеханических роботов должны учитывать плановые отказы роботов, связанные с копированием, а также возможность появления копий роботов или их отдельных узлов. Кроме перечисленных проблем, адаптация систем управления для нанороботов сопряжена с необходимостью учета возможности отторжения иммунной системой. С другой стороны, некоторые из возникающих проблем при определенных условиях могут быть превращены в преимущества. Например, создавая хранилище знаний для расширения функциональности наноробота, мы расширяем его функциональность уже самим
фактом
преимущество,
появления
хранилища.
На
поскольку
дополнительная
первый
взгляд
информация,
это
сомнительное
сообщаемая
самой
конструкцией хранилища может быть сама размещена в хранилище. Однако это не всегда так. В частности, для ряда классов трансдьюсеров языки, печатаемые этими трансдьюсерами, не распознаваемы трансдьюсерами из этих классов [115]. Таким образом, при грамотном подходе к построению хранилища информации для наноробота может оказаться, что конструкция хранилища будет более сложной информацией, чем то, что в нем хранится. Совершенно очевидно, что данный факт нельзя не учитывать при разработке систем коммуникации для нанороботов. Работа иммунной системы при определенных условиях тоже может быть положительной. Иммунная система достаточно хорошо изучена. Естественная иммунная система представляет собой сложный комплекс механизмов защиты от патогенных организмов. Основные
цели
иммунной
системы:
распознавание
всех
клеток
организма,
классификация их по принципу «свой – чужой», классификация чужих клеток по степени их опасности, нахождение подходящих механизмов защиты от опасных чужих клеток, запуск механизмов защиты. Иммунная система, работающая на клеточном уровне, состоит из клеток, называемых лимфоцитами [116]. Лимфоциты делятся преимущественно на две группы: T-клетки и B-клетки. Лимфоциты разных типов могут совместно бороться с опасными чужими клетками, либо действовать на лимфоциты другого типа, усиливая или понижая их активность. Когда лимфоциты обнаруживают
176
чужую
клетку,
они
начинают
производить
антитела,
предназначенные
для
уничтожения или нейтрализации чужой клетки. Информация о чужой клетке сохраняется в памяти иммунной системы. Поэтому повторное вторжение иммунная система будет отражать более успешно. Кроме иммунной системы, функционирующей на клеточном уровне, существует иммунная система, работающая внутри клетки. Эта система состоит из молекул РНК и ферментов, а также некоторой «базы знаний», записанной в ДНК. Деятельность этой системы сводится к уничтожению чужеродного или
бракованного
генетического
материала,
а
также
выработке
механизмов
компенсации мутаций. Хотя конструктивные элементы иммунных систем клеточного и субклеточного уровней существенно отличаются, принцип их функционирования отличается мало. Естественные иммунные системы дают нам интересный пример эффективной распределенной системы, позволяющей решать сложные вычислительные задачи. На сегодняшний день существует ряд теорий [117] – [119] и математических моделей
[120],
[121]
для
объяснения
феномена
иммунитета.
Имеется
ряд
компьютерных моделей [122] – [124] для симуляции различных частей иммунной системы. Разработано также несколько моделей интеллектуальных вычислений для решения алгоритмических проблем [116], [117], [120], [125] – [130]. Таким образом, вместо попыток преодоления иммунной системы можно использовать ее как естественный вычислительный механизм. К сожалению, большинство существующих моделей Bottom – Up AI рассматривают среду, в которой функционирует робот, преимущественно как набор препятствий. В то же время ДНК наномеханические роботы теоретически могут извлекать существенную пользу из среды, в которой они функционируют. В частности, работая в живой клетке, они могут получать от нее топливо, строительный материал. Они могут использовать естественную ДНК как внешний носитель информации. Соответственно они могут считывать эту информацию или инициировать на основе этой информации синтез каких-либо полезных молекул или других роботов. Вопрос о том, как и почему движется человеческое тело, с древнейших времен привлекал большое внимание исследователей. В результате сформировалась отдельная область знания, называемая теория действия. Хотя базовая идея теории действия была изложена еще Аристотелем (см. [131]), она сохранила свою актуальность и в наши дни
177
(см., например, [132]). Более того, область ее применения существенно расширилась в связи с появлением различных робототехнических устройств (см., например, [133], [134]). Суть этой идеи наиболее ярко отражена в вопросе Витгенштейна (см. [135]): ―What is left over if I subtract the fact that my arm goes up from the fact that I raise my arm?‖ Этот вопрос приводит к идее разделения собственно перемещения и того, что побуждает к этому перемещению. Нас могут интересовать самые различные изменения систем. Например, в случае человека это могут быть загар, покраснение или перемещения внутренних органов. В случае роботов – включение – выключение лампочки, изменение магнитного поля или давления масла и т.д. Учитывая то, что интересующее нас «движение», вообще говоря, не обязано быть чисто механическим или, будучи механическим, может быть не связано с изменением положения системы в пространстве, наиболее естественным представляется подход, основанный на описании «перемещений» при помощи абстрактных состояний. При этом мы полагаем, что система может принимать конечное множество a[1], a[2], … , a[m] абстрактных состояний. Соответственно, движение – это изменение состояния системы. Вопросы, связанные с формализацией побуждения к движению, представляются наиболее
трудными
и
интригующими.
Попытки
формализации
побуждения
существенно зависят от рассматриваемой системы. Однако для всех систем можно выделить две основные составляющие: механизм принятия решения и множество b[1], b[2], … , b[k] управляющих последовательностей. При этом мы полагаем, что любой переход из одного состояния в другое может быть описан при помощи некоторой управляющей последовательности. В этом случае в рамках теории действий управляющие
178
последовательности обычно называются действиями. При рассмотрении теории действия для человека основной интерес представляет изучение механизма принятия решения. Это связано с тем, что существенная часть проблем моделирования уже решена Природой. В частности, исследователю не надо конструировать ни систему состояний, ни систему действий. Не надо задумываться и над тем, где и как хранить правила взаимодействия состояний и действий. В случае же робототехнических систем разработку модели движения приходится начинать с «чистого листа». При построении моделей динамических систем, описывающих действия, осуществляемые системами, общий подход основан на рассмотрении эволюции состояния системы в зависимости от действий.
Соответственно
базовой
проблемой
моделирования
движения
робототехнических систем является создание модели описания взаимодействия состояний и действий. В том случае, когда у нас есть полная информация об изменении системы в зависимости от осуществляемых действий, эта информация может быть представлена как ориентированный граф с взвешенными дугами, вершинами которого являются состояния системы, а весами – действия. При этом сами дуги отражают изменение состояний в зависимости от действий. Эта модель достаточно удобна в применении, хотя и требует слишком больших затрат памяти. Например, у робота KAMRO (Karlsruhe Autonomous Mobile Robot) (см., например, [136] – [140]), разработанного Institute for Real-Time Computer Systems and Robotics (IPR), конструкция состоит из мобильной платформы, двух манипуляторов и нескольких сенсоров. Учитывая то, что количество состояний этого робота сравнительно мало, для управления этим роботом можно безболезненно пользоваться графом действий. У гуманоидного робота Nao AI-05, созданного в 2005 году Aldebaran Robotics, двадцать пять степеней свободы [141]. Робот Honda Humanoid Robot, созданный Honda Corporation, имеет тридцать степеней свободы [142], [143]. Даже такое небольшое количество степеней свободы, как отмечено, например, в [144], приводит к весьма значительному количеству состояний O(230) и существенно затрудняет использование теоретико-графовой
модели
теории
действий.
Эта
проблема
приобретает
катострофический размах при переходе на наноуровень. Особенно в случае ДНК. Рассмотрим, например, две молекулы ДНК одинаковой длины n, одна из которых целиком состоит из нуклеотидов A, а другая – из нуклеотидов T. Только различные
179
варианты образования комплементарных связей A – T обеспечат этой системе из двух молекул существенно больше O(2n) состояний. С учетом того, что даже у уже существующих ДНК наномеханических роботов количество нуклеотидов в одной молекуле может превышать 109, а количество самих молекул может быть более 1012, количество состояний ДНК наномеханических роботов может быть больше экспоненты от 1021. Совершенно ясно, что построение теоретико-графовой модели теории действий для таких роботов абсолютно невозможно. Другой подход к моделированию теории действий для роботов основан на рассмотрении логических теорий, описывающих правила изменения состояний в зависимости от действий (см., например, [145], [146]). Использование динамических логик позволяет существенно снизить затраты памяти. Однако такой подход нередко приводит к значительному повышению вычислительной сложности решаемых проблем (см., например, [147]), что тоже неприемлемо. Довольно часто существенно снизить вычислительную нагрузку позволяет переход от моделирования
состояний
всей
роботизированной
системы
к
моделированию
отдельных узлов. Например, рассмотрим робот видеонаблюдения. Пусть V – робот, состоящий из двух камер, способных работать в единственном режиме съемки. При этом камеры могут независимо друг от друга выполнять команды поворота по часовой стрелке вокруг своей оси на фиксированный угол. Первая камера может выполнять только команду p[1], предписывающую поворот на угол 2π / m для некоторой натуральной константы m. Соответственно вторая камера может выполнять только команду p[2], предписывающую поворот на угол 2 π / n для некоторой натуральной константы n. Выберем для каждой из камер некоторое положение в качестве положения с нулевым углом поворота. Из определения робота V очевидным образом следует, что его состояние полностью определяется парой углов поворота камер (φ,ψ), где φ = 2jπ / m, 0 ≤ j ≤ m-1, ψ = 2jπ / m, 0 ≤ j ≤ n-1. Множество команд, которые может выполнять робот, имеет вид
180
{ (p[1],1), (p[1],p[2]), (1,p[2]) }, где команда (p[1],p[2]) требует поворота обеих камер, а команды (p[1],1) и (1,p[2]) – только первой и только второй, соответственно. Таким образом, теоретико-графовая модель для этого робота представляет собой граф, имеющий mn вершин, из каждой из которых выходит три ребра, взвешенных командами
(p[1],1), (p[1],p[2]), (1,p[2]), соответственно. Легко понять, что вместо этого графа можно рассмотреть два графа, каждый из которых представляет одну камеру как самостоятельное устройство. Эти графы будут иметь m и n вершин, соответственно. Следовательно, мы получим квадратичное уменьшение модели. Легко понять, что при увеличении количества камер мы получим экспоненциальную экономию от числа камер. Однако подобная экономия возможна далеко не всегда, поскольку переход к моделированию отдельных узлов требует наличия у роботизированной системы независимых узлов. Например, система из двух манипуляторов, способных передавать друг другу предметы, не может быть разделена на два узла, поскольку при передаче предмета необходимо взаимодействие обоих манипуляторов. Более того, даже если отдельные части робота не вступают в непосредственный контакт, разделение может оказаться невозможным (например, роботизированная система может потерять равновесие и т.д.). В качестве разумного компромисса между теоретико-графовым подходом и подходом, основанным на использовании динамических логик, в этой работе мы рассмотрим алгебраический подход к описанию изменения состояния системы в зависимости от действий. Произвольный робот R можно рассматривать как некоторую конечную систему узлов A[1], A[2], … , A[n]
181
доступных для управления. При этом каждый из узлов A[i] может принимать конечное множество состояний a[i,1], a[i,2], … , a[i,p[i]]. Совокупность состояний отдельных узлов a[1,j[1]], a[2,j[2]], … , a[n,j[n]] в некоторый момент времени полностью определяет состояние всего робота в этот момент времени. Соответственно, для того чтобы изменить состояние робота, необходимо изменить состояния некоторых из его узлов. Без ограничения общности можно предполагать, что каждый из узлов управляется конечной системой команд. При этом системы команд различных узлов не пересекаются. Пусть система команд узла A[i] имеет вид b[i,1], b[i,2], … , b[i,q[i]]. Для удобства мы будем полагать, что
b[i,1]=1 для любого i. При этом единичную команду мы будем рассматривать как отсутствие команды. Совокупность команд отдельных узлов b[1,j[1]], b[2,j[2]], … , b[n,j[n]] в некоторый момент времени полностью определяет действие в этот момент времени. Рассмотрим полугруппу с внешне присоединенным нулем, порожденную множеством элементов
182
Ʃ = Φ Ψ, где Φ = Φ[1] … Φ[n], Φ[i] = { a[i,j] : 1 ≤ j ≤ p[i] }, Ψ = Ψ[1] … Ψ[n], Ψ[i] = { b[i,j] : 1 ≤ j ≤ q[i] }, и заданную множеством определяющих соотношений Q[0], где Q[0] = Q[0,1] Q[0,2] Q[0,3] Q[0,4] Q[0,5],
Q[0,1] = { a[i,j]a[s,t] = a[s,t]a[i,j] : 1 ≤ i ≤ n, 1 ≤ s ≤ n, 1 ≤ j ≤ p[i], 1 ≤ t ≤ p[s] },
Q[0,2] = { b[i,j]b[s,t] = b[s,t]b[i,j] : 1 ≤ i ≤ n, 1 ≤ s ≤ n, i s,
183
1 ≤ j ≤ q[i], 1 ≤ t ≤ q[s] },
Q[0,3] = { a[i,s]b[j,t] = b[j,t]a[i,s] : 1 ≤ i ≤ n, 1 ≤ j ≤ n, i j, 1 ≤ s ≤ p[i], 1 ≤ t ≤ q[j] } ,
Q[0,4] = { a[i,s]a[i,t] =0 : 1 ≤ i ≤ n, 1 ≤ s ≤ p[i], 1 ≤ t ≤ p[i] },
Q[0,5] = { b[i,t]a[i,s] = 0 : 1 ≤ i ≤ n, 1 ≤ s ≤ p[i], 1 ≤ t ≤ q[i] }.
184
Эту полугруппу мы будем называть базовой полугруппой робота R и обозначать S(R). Полугруппа S(R) при помощи своего множества определяющих соотношений задает пространство действий робота R. В дальнейшем для нас будут также представлять интерес
фактор-полугруппы полугруппы S(R), задаваемые в ней системой
определяющих соотношений Q, где Q = Q[0] Q[1] Q[2] Q[3] Q[4], Q[1] { a[i,s]b[i,j] = a[i,t] : 1 ≤ i ≤ n, 1 ≤ s ≤ p[i], 1 ≤ t ≤ p[i], 1 ≤ j ≤ q[i] }, Q[2] { aa[i,s]b[i,j] = aa[i,t] : 1 ≤ i ≤ n, 1 ≤ s ≤ p[i], 1 ≤ t ≤ p[i], 1 ≤ j ≤ q[i], a Φ+ }, Q[3] { a[i[1],s[1]]b[i[1],j[1]]a[i[2],s[2]]b[i[2],j[2]] … a[i[r],s[r]]b[i[r],j[r]] =
185
a[i[1],t[1]]a[i[2],t[2]] … a[i[r],t[r]] : 1 ≤ i[1] < i[2] < … < i[r] ≤ n, 1 ≤ s[1] ≤ p[i[1]], 1 ≤ s[2] ≤ p[i[2]], … , 1 ≤ s[r] ≤ p[i[r]], 1 ≤ t[1] ≤ p[i[1]], 1 ≤ t[2] ≤ p[i[2]], … , 1 ≤ t[r] ≤ p[i[r]], 1 ≤ j[1] ≤ q[i[1]], 1 ≤ j[2] ≤ q[i[2]], … , 1 ≤ j[r] ≤ q[i[r]] }, Q[4] { aa[i[1],s[1]]b[i[1],j[1]]a[i[2],s[2]]b[i[2],j[2]] … a[i[r],s[r]]b[i[r],j[r]] = aa[i[1],t[1]]a[i[2],t[2]] … a[i[r],t[r]] : 1 ≤ i[1] < i[2] < … < i[r] ≤ n,
r < n, 1 ≤ s[1] ≤ p[i[1]], 1 ≤ s[2] ≤ p[i[2]], … , 1 ≤ s[r] ≤ p[i[r]], 1 ≤ t[1] ≤ p[i[1]], 1 ≤ t[2] ≤ p[i[2]], … , 1 ≤ t[r] ≤ p[i[r]], 1 ≤ j[1] ≤ q[i[1]], 1 ≤ j[2] ≤ q[i[2]], … , 1 ≤ j[r] ≤ q[i[r]], a ((Φ[1] … Φ[n] ) \ (Φ[i[1]] … Φ[i[r]]))+ } . Множество Q[1] определяет изменения состояний узлов робота, не зависящие от текущих состояний других узлов. Множество Q[2] задает изменения состояний узлов, которые возможны лишь в том случае, когда некоторые другие узлы находятся в подходящих состояниях. Системы Q[3] и Q[4] определяют изменения состояний узлов,
186
которые
должны происходить синхронно. При этом множество Q[3] задает
синхронные изменения состояний узлов робота, не зависящие от текущих состояний других узлов. Соответственно множество Q[4] задает синхронные изменения состояний узлов, которые возможны лишь в том случае, когда некоторые другие узлы находятся в подходящих состояниях. Несложно проверить, что если для некоторого i, 1 ≤ i ≤ n, слово w Ʃ+ содержит более одного вхождения букв из множества Φ[i], то в полугруппе S(R) слово w равно нулю. Кроме того, произвольное слово w Ʃ+ в полугруппе S(R) представимо в виде x[1]x[2] … x[n] 1, где для любого i имеет место соотношение x[i] ( Φ[i] Ψ[i] )*. Отсюда вытекает, что произвольный элемент w полугруппы S(R) равен нулю или слову вида x[1]x[2] … x[n], где x[1]x[2] … x[n] 1,
x[i] = y[i]z[i], y[i] { 1 } Φ[i], z[i] Ψ[i]*. Такое представление элементов полугруппы S(R) будем называть каноническим. Для произвольной полугруппы S(R) по произвольному представлению элемента его каноническое представление может быть эффективно построено за полиномиальное время. Канонические представления ненулевых элементов полугруппы S(R) находятся
187
во взаимно однозначном соответствии с парами всевозможных состояний робота R и потенциально
применимых
программ.
Фактор-полугруппы
полугруппы
S(R),
получаемые добавлением некоторого множества определяющих соотношений Q, определяют пространство состояний – действий робота R. Следует отметить, что в худшем случае полугрупповая модель не дает преимущества по сравнению с графовой. Однако для того, чтобы достигнуть худшего случая необходимо, чтобы у робота все степени свободы во всех состояниях зависели друг от друга. Поскольку для ДНК характерно то, что подавляющее большинство взаимодействий определяется лишь несколькими соседними нуклеотидами, для ДНК наномеханических
устройств
полугрупповая
модель
сочетает
компактность
динамических логик и вычислительную эффективность графовых моделей. В
рамках
только
что
рассмотренной
модели
применительно
к
ДНК
наномеханическим устройствам попарное различие узлов A[1], A[2], … , A[n] и систем команд b[i,1], b[i,2], … , b[i,q[i]] обусловлено необходимостью обозначить позиции нуклеотидов в устройстве, к которым применяются действия. Однако поскольку количество типов нуклеотидов ограничено, в любом достаточно большом устройстве нуклеотиды одного и того же типа должны повторяться многократно в различных местах. Поэтому многие команды, различающиеся в модели, будут совпадать на физическом уровне. Следовательно, имеет смысл рассмотреть соответствие между множеством формальных программ F и множеством реальных команд E, выполняемых на физическом уровне. Будем говорить, что элемент x из F находится в отношении ρ с элементом y из E, если модельная команда x кодирует команду y. Рассмотрим частично упорядоченные множества (P(F),) и (P(E),) всех подмножеств множеств Fи E, соответственно. Это множества всех формальных программ и всех программ физического уровня. Бинарный контекст (см. [148]) (F,E,ρ) индуцирует соответствие Галуа (f,g) между множествами (P(F),) и (P(E),), задаваемое отображениями f : X xX { y : y F, x ρ y }, g : Y yY { x : x E, x ρ y }.
188
Соответствие Галуа (f,g) индуцирует оператор замыкания h=gf на множестве (P(F),) (см. [149]): X h(X); X Y h(X) h(Y);
h(h(X)) = h(X). Пусть L – множество всех элементов (X,Y) из декартова произведения (P(F),) и (P(E),) таких, что h(X) = X и f(X) = Y. На множестве L рассмотрим бинарное отношение , задаваемое соотношением (X[1],Y[1]) (X[2],Y[2]) X[1] X[2]. Пара (L,) является полной решеткой и называется решеткой Галуа бинарного контекста (F,E,ρ) (см. [150]). Решетка Галуа задает сжимающее отображение множества (P(F),) на (P(E),). Применение возможность
моделей
проводить
и
алгоритмов
тестирование
классической
отдельных
робототехники
элементов
наносистем
дает на
макроуровне. В частности, для структурного моделирования нанорешеток и наноустройств могут быть эффективно применены результаты исследований по разработке
моделей
и
алгоритмов
для
метаморфных
(metamorphic)
или
самореконфигурующихся (self-reconfigurable) роботов (см. [151] – [166]). Для исследования
алгоритмов
управления
движением
наномеханических
роботов
представляют существенный интерес также алгоритмы неголономного управления
189
движением роботов (см. [167] – [185]) и алгоритмы вероятностного управления движением роботов (см. [186] – [204]). Совершенно естественно, что для ДНК наномеханических устройств пригодны многие идеи, модели и алгоритмы, разрабатываемые и применяемые для нанороботов в целом. В частности, ведутся исследования в области автоматического планирования (см., например, [205] – [209]), моделирования представления знаний (см., например, [210] – [212]), разработки систем управления механическим движением (см., например, [213] – [220]), создания графических симуляторов (см., например, [221] – [225]). Литература
1.
Garzon M., Drumwright E., Deaton R., Renault D. Virtual test tubes: a new methodology for computing // Proceedings of 7th International Symposium on String Processing and Information Retrieval. IEEE Computer Society Press, 2000. P.116121.
2.
Garzon M., Oehmen C. Biomolecular computation in virtual test tubes // Lecture Notes in Computer Science 2340. 2002. P.117–128.
3.
Garzon M.H., Blain D.R., Neel A.J. Virtual test tubes // Natural Computing. 2004. V.3. P.461–477.
4.
Ichinose
N.
Hybrisim:
Dna
hybridization
simulator.
http://www.genome.ist.i.kyoto-u.ac.jp/ ichinose/bio/hybrisim/. 5.
Nishikawa A., Hagiya M., Yamamura M. Virtual dna simulator and protocol design by ga // Proceedings of the Genetic and Evolutionary Computation Conference, GECCO‘99. 1999. V.2. P.1810–1816.
6.
Nishikawa A., Yamamura M., Hagiya M. Dna computation simulator based on abstract bases // Soft Computing. 2001. V.5. P.25–38.
7.
Bois J.S., Venkataraman S., Choi H.M.T., Spakowitz A.J., Wang Z., Pierce N.A. Topological constraints in nucleic acid hybridization kinetics // Nucleic Acids Research. 2005. V.33. P.4090–4095.
8.
Dirks R.M., Bois J.S., Schaeffer J.M., Winfree E., Pierce N.A. Thermodynamic analysis of interacting nucleic acid strands // SIAM Rev. 2007. V.49. P.65–88.
190
9.
Arteca G.A., Edvinsson T., Elvingson C. Compaction of grafted wormlike chains under variable confinement // Phys. Chem. Chem. Phys. 2001. V.3. P.3737–3741.
10.
Malevanets A., Yoemans J.M. Dynamics of short polymer chains in solution // Europhysics Letters. 2000. V.52. P.231.
11.
Sales-Pardo M., Guimera R., Moreira A.A., Widom J., Amaral L.A. Mesoscopic modeling for nucleic acid chain dynamics // Phys Rev E Stat Nonlin Soft Matter Phys. 2005. V.71. P.051902.
12.
Zhang Y., Zhou H., Ou-Yang Z. Stretching single-stranded dna: Interplay of electrostatic, base-pairing, and base-pair stacking interactions // Biophys J. 2001. V.81. P.1133–1143.
13.
Flamm C., Fontana W., Hofacker I.L., Schuster P.. Rna folding at elementary step resolution // RNA. 2000. V.6. P.325–338.
14.
Isambert H., Siggia E.D. Modeling rna folding paths with pseudoknots: application to hepatitis delta virus ribozyme // Proc Natl Acad Sci U S A. 2000. V.97. P.6515– 6520.
15.
Wolfinger M.T., Svrcek-Seiler W.A., Flamm C., Hofacker I.L., Stadler P.F. Exact folding dynamics of rna secondary structures // J.Phys.A: Math.Gen. 2004. V.37. P.4731–4741.
16.
Frank-Kamenetskii M.D. Biophysics of dna molecule // Phys. Rep. 1997. V.288. P.13 – 60.
17.
Gillespie D.T. Exact stochastic simulation of coupled chemical reactions // J. Phys. Chem. 1977. V.81. P.2340–2361.
18.
Gillespie D.T. Approximate accelerated stochastic simulation of chemically reacting systems // J. Chem. Phys. 2001. V.115. P.1716–1733.
19.
Hastings W.K. Monte carlo sampling methods using Markov chains and their applications // Biometrika. 1970. V.57. P.97–109.
20.
Kierzek A.M. Stocks: Stochastic kinetic simulations of biochemical systems with Gillespie algorithm // Bioinformatics. 2002. V.18. P.470–481.
21.
Metropolis N., Rosenbluth A.W., Rosenbluth M.N., Teller A.H., Teller E. Equations of state calculations by fast computing machines // Journal of Chemical Physics. 1953. V.21. P.1087–1092.
191
22.
Rao C., Arkin A. Stochastic chemical kinetics and the quasi-steady-state assumption: application to the Gillespie algorithm // J. of Chem. Phys. 2003. V.118. P.4999–5010.
23.
Turner T.E., Schnell S., Burrage K. Stochastic approaches for modelling in vivo reactions // Computational Biology and Chemistry. 2004.
24.
Aragon S.R., Pecora R. Dynamics of wormlike chains // Macromolecules. 1985. V.18. P.1868–1875.
25.
Bouchiat C., Wang M.D., Allemand J., Strick T., Block S.M., Croquette V. Estimating the persistence length of a worm-like chain molecules from forceextension measurements // Biophys. J. 1999. V.76. P.409–413.
26.
Bustamante C., Marko J.F., Siggia E.D., Smith S. Entropic elasticity of lambdaphage dna mechanics // Science. 1994. V.265. P.1599.
27.
Dimitrakopoulos P. Stress and configuration relaxation of an initially straight flexible polymer // J. Fluid Mech. 2004. V.513. P.265–286.
28.
Doyle P.S., Underhill P.T. Brownian dynamics simulations of polymers and soft matter // S. Yip, editor. Handbook of Materials Modeling. 2005. P.2619–2630.
29.
Fixman M., Kovac J. Polymer conformation statistics iii: Modified Gaussian models of the stiff chains // J. Chem. Phys. 1973. V.58. P.1564–1568.
30.
Fournier J.B. Wormlike chain or tense string? a question of resolution // Continuum Mechanical Thermodynamics. 2002. V.14. P.241.
31.
James H.M., Guth E. Theory of the elastic properties of rubber // Journal of Chemical Physics. 1943. V.10. P.455–481.
32.
Klenin K., Merlitz H., Langowski J. A brownian dynamics program for the simulation of linear and circular dna and other wormlike chain polyelectrolytes // Biophys J. 1998. V.74. P.780–788.
33.
Kovac J., Crabb C. Modified gaussian model for rubber elasticity. 2. the wormlike chain // Macromolecules. 1982. V.15. P.537.
34.
Kuhn M., Grun F. Relationships between elastic constants and stretching double refraction of highly elastic substances // Kolloid-Z. 1942. V.101. P.294.
35.
Kutter S. Elasticity of polymers with internal topological constraints. PhD thesis, August 2002.
192
36.
Ladoux B., Quivy J.P., Doyle P.S., Almouzni G., Viovy J.L. Direct imaging of single-molecules: from dynamics of a single dna chain to the study of complex dnaprotein interactions // Sci. Prog. 2001. V.84. P.267.
37.
Larson R.G., Perkins T., Smith D., Chu S. Hydrodynamics of a dna molecule in a flow field // Phys. Rev. E. 1997. V.55. P.1794–1797.
38.
Larson R.G., Perkins T.T., Smith D.E., Chu S. Brownian dynamics simulations of a dna molecule in an extensional flow field // J. Rheol. 1999. V.43. P.267.
39.
Marko J.F., Siggia E.D. Bending and twisting elasticity of dna // Macromolecules. 1994. V.27. P.981.
40.
Marko J.F., Siggia E.D. Stretching dna // Macromolecules. 1995. V.28. P.8759.
41.
Murphy M.C., Rasnik I., Cheng W., Lohman T.M., Ha T.. Probing singlestranded dna conformation flexibility using fluorescence spectroscopy // Biophysical Journal. 2004. V.86. P.2530–2537.
42.
Odijk T. Stiff chains and filaments under tension // Macromolecule. 1995. V.28. P.7016–7018.
43.
Pedersen J.S., Laso M., Schurtenberger P.. Monte Carlo study of excluded volume effects in wormlike micelles and semiflexible polymers // Phys Rev E. 1996. V.54. P.5917–5920.
44.
Smith S.B., Cui Y., Bustamante C. Overstretching b-dna: the elastic response of individual double-stranded and single-stranded dna molecules // Science. 1996. V.271. P.795–799.
45.
Smith S.B., Finzi L., Bustamante B. Direct mechanical measurements of the elasticity of single dna molecules by using magnetic beads // Science. 1992. V.258. P.1122.
46.
Tinoco I., Bustamante C. The effect of force on thermodynamics and kinetics of single molecule reactions // Biophys Chem. 2002. V.101-102. P.513–533.
47.
Yamakawa H., Yoshizaki T. Dynamics of helical wormlike chains and dynamic model and diffusion equation // Journal of Chemical Physics. 1981. V.75. P.1016– 1030.
193
48.
Butler J.E., Shaqfeh E.S.G. Brownian dynamics simulations of a flexible polymer chain which includes continuous resistance and multi-body hydrodynamic interaction // Journal of Chemical Physics. 2005. V.122. P.14901.
49.
Heath P.J., Gebe J.A., Allison S.A., Schurr J.M. Comparison of analytical theory with brownian dynamics simulations for small linear and circular dnas // Macromolecules. 1996. V.29. P.3583.
50.
Hur J.S., Shaqfeh E.S.G. Brownian dynamics simulations of single dna molecule in shear flow // J. Rheol. 2000. V.44. P.713–742.
51.
Jendrejack R.M., Pablo J.J., Graham M.D. Stochastic simulations of dna in flow: Dynamics and the effects of hydrodynamic interactions // Journal of Chemical Physics. 2002. V.116. P.7752.
52.
Langowski J. Polymer chain models of dna and chromatin // The European Physical Journal E. 2006. V.19. P.241–249.
53.
Larson R.G., Hu H., Smith D.E., Chu S. Brownian dynamics simulation of a dna molecule in an extensional flow field // J. Rheol. 1999. V.43. P.267–304.
54.
Somasi M., Khomami B., Woo N.J., Hur J.S., Shaqfeh E.S.G. Brownian dynamics simulations of bead-rod and bead-spring chains: numerical algorithms and coarsegraining issues // J. Non-Newtonian Fluid Mech. 2002. V.108. P.227–255.
55.
SantaLucia Jr. J. A unified view of polymer, dumbbell and oligonucleotide dna nearest-neighbor thermodynamics // PNAS. 1998. V.95. P.1460–1465.
56.
Alberts B., Bray D., Johnson A., Lewis J., Raff M., Roberts K., Walter P. Essential Cell Biology – An Introduction to the Molecular Biology of the Cell. Garland Publishing, 1998.
57.
Lodish H., Berk A., Zipursky S.L., Matsudaira P., Baltimore D., Darnell J. Molecular Cell Biology. Fourth edition. W. H. Freeman and Company, 2000.
58.
Pollard T.D., Earnshaw W.C. Cell Biology. Updated edition. Saunders, 2004.
59.
Suda T., Moore M., Nakano T., Egashira R., Enomoto A., Hiyama S., Moritani Y. Exploratory Research in Molecular Communication between Nanomachines // UCI Technical Report, 05-3, Mar. 2005.
194
60.
Hiyama S., Moritani Y., Suda T., Egashira R., Enomoto A., Moore M., Nakano T. Molecular Communication // NSTI Nanotechnology Conference and Trade Show. 2005. V.3. P.392-395.
61.
Moritani Y., Hiyama S., Suda T. Molecular Communication for Health Care Applications //
62.
Moritani Y., Hiyama S., Suda T. Molecular Communication among Nanomachines Using Vesicles // NSTI-Nanotech 2006. 2006. V.2. P.705-708.
63.
Dautenhahn K. Getting to know Each Other Artificial Social Intelligence for Autonomous Robots // P. Gaussier editor. Special Issue of Robotics and Autonomous Systems. Moving the Frontiers between Robotics and Biology. 1997. V.16.
64.
Kauffman S.A. The origins of Order: Selforganization and Selection in Evolution. Oxford University Press, NewYork, 1993.
65.
Maes P. BehaviorBased Artificial Intelligence // Proceedings of the Fifteenth Annual Meeting of the Cognitive Science Society. Hillsdale, NJ, 1993. P.74-83.
66.
Maturana H., Varela F.J. Autopoiesis and Cognition: the realization of the living. Reidel, Boston, MA, 1980.
67.
Maturana H., Varela F.J. The Tree of Knowledge: The biological roots of human understanding. New Science Library, Boston, MA, 1987.
68.
Varela F.J., Thompson E., Rosch E. The embodied mind: Cognitive science and human experience. MIT Press, Cambridge, MA, 1991.
69.
Brooks R.A. A robust control system for a mobile robot // IEEE Journal of Robotics and Automation. 1986. V.2.
70.
Agre P.E., Chapman D. Pengi: AN Implementation of a theory of activity // AAAI'87. 1987. P.268272.
71.
Agre P.E., Chapman D. What are plans for // Designing Autonomous Agents. Pattie Maes Eds. MIT Press, 1990.
72.
Malcolm C., Smithers T. Symbol grounding via a hybrid architecture in an autonomous assembly system // Designing Autonomous Agents. Pattie Maes Eds. MIT Press, 1990.
195
73.
Mataric M.J. Navigation with a rat brain: a neurobiologically inspired model for robot spatial representation // Proceedings of the first international conference on simulation of adaptive behaviors. MIT Press, 1990.
74.
Mori H. et al. A mobile robot strategy applied to Harunobu4 // Proceedings of the Conference on Pattern Recognition. Rome, 1988.
75.
Gat Y., Muller J.P. Reactive navigation based on simple world modeling // Proceedings of the 9th Israeli Symposium on Artificial Intelligence. Ramat Gan, Israel, 1992. P.4356.
76.
Gat Y., Rodriguez M., Muller J.P. Enriched Sensitive Localization // Proceedings of the Fourth Annual Meeting of the Swiss Group for Artificial Intelligence and Cognitive Science. Neuchatel, 1992.
77.
Mataric M.J., Brooks R. Learning a distributed map representation based on navigation behaviors // Proceedings of the USAJapan Symposium on flexible automation. Kyoto, Japan, 1990. P.499506.
78.
Mataric M.J. Environment learning using a distributed representation // Proceedings of the IEEE International Conference on Robotics and Automation. 1990.
79.
Muller J.P., Hugli H. et al. Architecture for an autonomous system: application to mobile robot navigation // IIIA, Universite de Neuchatel, Tech. report RT92/51, 1992.
80.
Steels L. Emergent adaptive lexicons // Maes P., editor. From Animals to Animats 4: Proceedings of the Fourth International Conference On Simulating Adaptive Behavior. Cambridge Ma, The MIT Press, 1996.
81.
Steels L. Perceptually grounded meaning creation // Tokoro M., editor, Proceedings of the International Conference on MultiAgent Systems. Menlo Park Ca, AAAI Press, 1996.
82.
Steels L. The synthetic modeling of language origins // Evolution of Communication. 1997. V.1. N1. P.1-34.
83.
Steels L., Kaplan F. Stochasticity as a source of innovation in language games // Proceedings of Alive VI. 1997.
84.
Hurford J., Knight C., StuddertKennedy M. Evolution of Human Language. Edingburgh University Press, Edingburgh, 1998.
196
85.
Kirby S., Hurford J. Learning, culture and evolution in the origin of linguistic constraints // Husbands C. and Harvey I., editors, Proceedings of the Fourth European Conference on Artificial Life. Cambridge Ma. and London, MIT Press, 1997.
86.
McLennan B. Synthetic ethology: an approach to the study of communication // Langton C., Taylor C., Farmer J., editors. Artificial Life II, Vol. X of SFI Studies in the Sciences of Complexiy. Redwood City, Ca. AddisonWesley Pub. Co, 1991.
87.
Oliphant M. The dilemma of saussurean communication // Biosystems. 1996. V.37. P.31-38.
88.
Prigogine I., Strengers I. Order out of Chaos. Bantam Books, New York, 1984.
89.
Werner G., Dyer M. Evolution and communication in artificial organisms // Langton C., Taylor C., Farmer, J., editors. Artificial Life II, Vol. X of SFI Studies in the Sciences of Complexiy. Redwood City, Ca. AddisonWesley Pub. Co, 1991.
90.
Belpaeme T., Steels L., van Looveren J. The construction and acquisition of visual categories // Birk A. and Demiris J., editors. Learning Robots, Proceedings of the EWLR6, Lecture Notes on Artificial Intelligence 1545. Springer, 1998.
91.
Billard A., Hayes G. Robot's first steps, robot's first words ... // Sorace and Heycock, editors. Proceedings of the GALA '97 Conference on Language Acquisition Edingburgh, Human Communication Research Centre. University of Edinburgh, 1997.
92.
Billard A., Hayes G. Drama, a connectionist architecture for control and learning in autonomous robots // Adaptive Behaviour. 1999. V.7.
93.
De Jong E. D. Coordination developed by learning from evaluations // Notes of the VIM'97 Workshop on Collaboration between human and artificial societies. Universita' di Salerno, 1997.
94.
De Jong E. D., Vogt P. How should a robot discriminate between objects? // Pfeifer R., Blumberg B., Meyer J.A., and Wilson S., editors. From animals to animats 5. Proceedings of the fifth internation conference on simulation of adaptive behavior. Cambridge, Ma. MIT Press, 1998.
95.
Harnad S. The symbol grounding problem // Physica D. 1990. V.42. P.335-346.
197
96.
Rosenstein M., Cohen P. R. Concepts from time series // Proceedings of the Fifteenth National Conference on Artificial Intelligence. Menlo Park Ca. AAAI Press, 1998.
97.
Steels L., Vogt P. Grounding adaptive language games in robotic agents // Husbands C. and Harvey I., editors. Proceedings of the Fourth European Conference on Artificial Life. Cambridge Ma. and London, MIT Press, 1997.
98.
Tani J., Nolfi S. Learning to perceive the world as articulated: An approach for hierarchical learning in sensorymotor systems // Pfeifer R., Blumberg B., Meyer J.A., Wilson S., editors. From animals to animats 5. Proceedings of the fifth internation conference on simulation of adaptive behavior. Cambridge, Ma, MIT Press, 1998. Brassac C., Pesty S. Cooperation dans les systemes multiagents, comportement ou
99.
conduite? // Proceedings of the first international workshop on decentralized intelligent and multiagent systems, Krakow, Poland, 1995. 100.
ChaibDraa B. Interaction between Agents in routine, familiar and unfamiliar
situations // International Journal of Intelligent and Cooperative Information Systems. 1996. V.5. 101.
Chantemargue F., Krone O., Schumacher M., Dagaeff T., Hirsbrunner B.
Autonomous Agents: from Concepts to Implementation // Proceedings of the Fourteenth European Meeting on Cybernetics and Systems Research (EMCSR'98). Vienna, Austria, April 1417, 1998. V.2. P.731-736. 102.
Dagaeff T., Chantemargue F., Hirsbrunner B. Emergencebased Cooperation in a
MultiAgent System // Proceedings of the Second European Conference on Cognitive Science (ECCS'97). Manchester, U.K., April 911, 1997. P.91-96. 103.
Ferber J. Les systemes multiagents, vers une intelligence collective. InterEditions,
Paris, 1995. 104.
Ferber J., Labbani O., Muller J.P., Bourjault A. Formalizing Emergent Collective
Behaviors: preliminary report // DAIMAS'97, St Petersbourg, Russia, June 1997. 105.
Malone T.W., Crowston K. The Interdisciplinary Study of Coordination // ACM
Computing Surveys. 1994. V.26. P.87-119.
198
106.
Muller J.P. Formalizing emergent collective behaviours: preliminary report //
Swiss Workshop on Collaborative and Distributed Systems. Lausanne, Switzerland, May 2, 1997. 107.
Scaglione M.E. Les Modeles de la Vie Artificielle et les Concepts d'Emergence: de
la metaphore
a la realization // Quelles relations entretenonsnous avec nos
mod‗eles?, Rochebrune, France, Fevrier 1-7, 1998. 108.
Steels L., Brooks R. The artificial life route to artificial intelligence. Building
Embodied, Situated Agents. Lawrence Erlbaum, Hillsdale, NJ, USA, 1994. 109.
Pattie Maes Eds. Designing Autonomous Agents, MIT Press, 1990.
110.
Brooks R.A. Intelligence without Reason // Proceedings of IJCAI91. Sydney,
Australia, 1991. 111.
Franklin S., Graesser A. Is it an Agent or just a Program? A Taxonomy for
Autonomous Agents // J.P. Muller, M.J. Wooldridge, and N.R. Jennings, editors. Proceedings of ECAI'96 Workshop (ATAL). Intelligent Agents III. Agent Theories, Architectures, and Languages, number 1193 in Lectures Notes in Artificial Intelligence. 1996. P.21-35. 112.
112.Pfeifer R. Building Fungus Eaters: Design Principles of Autonomous Agents
// Maes, Mataric, Meyer, Pollack, and Wilson, editors. Proceedings of the Fourth International Conference on Simulation of Adaptive Behavior, volume 4 From Animals to Animats. Cambridge, MA, MIT Press/Bradford Books, 1996. 113.
Steels L. When are robots intelligent autonomous agents? // Robotics and
Autonomous systems. 1995. 114.
Ziemke T. Adaptive Behavior in Autonomous Agents // Autonomous Agents,
Adaptive Behaviors and Distributed Simulations journal, 1997. 115.
Окуловский Ю.С., Попов В.Ю. Языки, порождаемые трансдьюсерами с
магазинной памятью // Безопасность информационного пространства. Сборник трудов
VI
аспирантов
межвузовской и
молодых
научно-практической ученых.
Тюмень:
конференции Издательство
студентов, Тюменского
государственного университета, 2007. С.175-176. 116.
Jerne N.K. The immune system // Scientific American. 1973. V. 229. N 1. P. 52 –
60.
199
117.
Jerne N.K. Towards a network theory of the immune system // Ann. Immunol.
(Inst. Pasteur). 1974. V. 125C. P. 373 – 389. 118.
Mohler R.R., Bruni C., Gandolfi A. A System Approach to Immunology //
Proceedings of the IEEE. 1980. V. 68. N. 8. P. 964 – 990. 119.
Weisbuch G. A shape space approach to the dynamics of the immune system //
Journal of Theoretical Biology. 1990. V. 143. N. 4. P. 507 – 522. 120.
Perelson A.S. Immune network theory // Immunological Reviews. 1989. N. 10. P.
5 – 36. 121.
Varela F.J., Stewart J. Dynamics of a class of immune networks I. Global Stability
of idiotype interactions // Journal of Theoretical Biology. 1990. V. 144. N. 1. P. 93 – 101. 122.
Celada F., Seiden P.E. A computer model of cellular interactions in the immune
system // Immunology Today. 1992. V. 13. N. 2. P. 56 – 62. 123.
Vertosick F.T., Kelly R.H. Immune network theory: a role for parallel distributed
processing? // Immunology. 1989. V. 66. P. 1 – 7. 124.
Weinand R.G. Somatic mutation, affinity maturation and antibody repertoire: A
computer model // Journal of Theoretical Biology. 1990. V. 143. N. 3. P. 343 – 382. 125.
Forrest S., Perelson A.S., Allen L., Cherukuri R. SelfNonself Discrimination in a
Computer // Proceedings of IEEE Symposium on Research in Security and Privacy, Oakland, CA, 1994. P. 202 – 212. 126.
Helman P., Forrest S. An Efficient Algorithm for Generating Random Antibody
Strings // Technical Report No. CS947, Department of Computer Science, University of New Mexico, 1994. 127.
Bersini H., Varela F.J. Hints for adaptive problem solving gleaned from immune
networks // Proceedings of the first workshop on Parallel Problem Solving from Nature, 1990. P. 343 – 354. 128.
Farmer J.D., Packard N.H., Perelson A.S. The immune system, adaptation, and
machine learning // Physica D. 1986. V. 22. P. 187 – 204. 129.
Forrest S., Javornik B., Smith R., Perelson A.S. Using genetic algorithms to
explore pattern recognition in the immune system // Evolutionary Computation. 1993. V. 1. N 3. P. 191 – 211.
200
130.
Hoffmann G.W. A neural network model based on the analogy with the immune
system // Journal of Theoretical Biology. 1986. V. 122. P. 33 – 67. 131.
Aristotle. Nicomachean Ethics (Third Book).
132.
Mele A., Eds. The Philosophy of Action. Oxford University Press, Oxford, 1997.
133.
De Giacomo G., Iocchi L., Nardi D., Rosati R. Moving a robot starting from a
theory of actions. 134.
Peters J., Vijayakumar S., Schaal S. Reinforcement learning for humanoid robotics
// Humanoids2003, Third IEEE-RAS International Conference on Humanoid Robots, Karlsruhe, Germany, Sept.29-30, 2003. 135.
Ludwig Wittgenstein, Philosophical Investigations §621.
136.
Dumm M. Automatische Behandlung von Ausnahmesituationen bei Montagevor
angen. Master's thesis, Fakult¨at f¨ur Informatik, Univ. Karlsruhe, 1991. 137.
Langle T., Luth T.C., Stopp E., Herzog G., Kamstrup G. KANTRA - A Natural
Language Interface for Intelligent Robots // U. Rembold, R. Dillman, L. O. Hertzberger, T. Kanade, eds. Intelligent Autonomous Systems (IAS 4). IOS, Amsterdam, 1995. P.357-364. 138.
Luth T.C., Langle T., Herzog G., Stopp E., Rembold U. KANTRA: Human-
Machine Interaction for Intelligent Robots Using Natural Language // 3rd IEEE Int. Workshop on Robot and Human Communication, RO-MAN'94. Nagoya, Japan, 1994. P.106-111. 139.
Luth T.C., Rembold U. Extensive Manipulation Capabilities and Reliable
Behaviour at Autonomous Robot Assembly // Proc. of IEEE Int. Conf. on Robotics and Automation, San Diego, CA, 1994. 140.
Langle T., Luth T.C., Stopp E., Herzog G. Natural Language Access to Intelligent
Robots: Explaining Automatic Error Recovery // A. M. Ramsay, Eds. Artificial Intelligence: Methodology, Systems, Applications. Amsterdam: IOS, 1996. P.259-267. 141.
http://aldebaran-robotics.com
142.
Hirai K. Current and future perspective of Honda humamoid robot // Proceedings
of the 1997 IEEE/RSJ International Conference on Intelligent Robot and Systems. Grenoble, France: IEEE, New York, NY, USA, 1998. P.500-508.
201
143.
Hirai K., Hirose M., Haikawa Y., Takenaka T. The development of Honda
humanoid robot // IEEE International Conference on Robotics and Automationp. Leuven, Belgium: IEEE, New York, NY, USA, 1998. P.1321-1326. 144.
Schaal S. Is imitation learning the route to humanoid robots? // Trends in
Cognitive Sciences. 1999. V.3. P.233-242. 145.
Rosenschein S. Plan synthesis: a logical approach // Proc. of the 8th Int. Joint
Conf. on Artificial Intelligence. 1981. 146.
Schild K. A correspondence theory for terminological logics: Preliminary report //
Proceedings of the Twelfth International Joint Conference on Artificial Intelligence (IJCAI91). 1991. P.466-471. 147.
Kozen D., Tiuryn J. Logics of programs // van Leeuwen J., eds. Handbook of
Theoretical Computer Science. Elsevier Science Publishers (NorthHolland), Amsterdam, 1990. P.790-840. 148.
Wille R. Restructuring lattice theory: an approach based on hierarchies of concepts
// I. Rival, editor. Ordered sets. Ridel, Dordrecht-Boston, 1982. P.445-470. 149.
Birkhoff G. Lattice theory. 3rd edition, Coll. Publ., XXV. American Mathematical
Society, Providence, RI, 1967. 150.
Barbut M., Monjardet B. Ordre et classification. Hachette, Paris, 1970.
151.
Casal A., Yim M. Self-reconfiguration planning for a class of modular robots //
Proceedings of SPIE, Sensor Fusion and Decentralized Control in Robotic Systems II. 1999. V.3839. P.246-255. 152.
Donald B.R., Xavier P.G., Canny J.F., Reif J.H. Kinodynamic motion planning //
Journal of the ACM, 1993. V.40. N5. P.1048-1066, 153.
Kotay K., Rus D. Generic distributed assembly and repair algorithms for self-
reconfiguring robots // Proc. of IEEE Intl. Conf. on Intelligent Robots and Systems, 2004. 154.
Pamecha A., Chiang C., Stein D., Chirikjian G. Design and implementation of
metamorphic robots // Proceedings of the 1996 ASME Design Engineering Technical Conference and Computers in Engineering Conference, 1996. 155.
Pamecha A., Ebert-Uphoff I., Chirikjian G. Useful metrics for modular robot
motion planning // IEEE Trans. Robot. Automat. 1997. P.531–545.
202
156.
Rus D., Vona M. Crystalline robots: Self-reconfiguration with unitcompressible
modules // Autonomus Robots. 2001. V.10. N1. P.107–124. 157.
Reif J.H., Slee S. Asymptotically optimal kinodynamic motion planning for self-
reconfigurable robots // Seventh International Workshop on the Algorithmic Foundations of Robotics (WAFR2006), NYC, New York, July 16-18, 2006. 158.
Reif J.H., Slee S. Optimal Kinodynamic Motion Planning for Self-Reconfigurable
Robots Between Arbitrary 2D Configurations // Robotics: Science and Systems Conference, Georgia Institute of Technology, Atlanta, GA, June 27-30, 2007. 159.
Vassilvitskii S., Suh J., Yim M. A complete, local and parallel reconfiguration
algorithm for cube style modular robots // Proc. of the IEEE Int. Conf. on Robotics and Automation, 2002. 160.
Vassilvitskii S., Kubica J., Rieffel_E., Suh J., Yim M. On the general
recon_guration problem for expanding cube style modular robots // Proceedings of the 2002 IEEE Int. Conference on Robotics and Automation. 2002. P.801-808. 161.
Vona M., Rus D. Self-reconfiguration planning with compressible unit modules //
1999 IEEE International Conference on Robotics and Automation, 1999. 162.
Walter J., Tsai B., Amato N. Choosing good paths for fast distributed
reconfiguration of hexagonal metamorphic robots // Proc. of the IEEE Intl. Conf. on Robotics and Automation, 2002. P.102–109. 163.
Walter J.E., Welch J.L., Amato N.M.. Distributed reconfiguration of metamorphic
robot chains // PODC ‘00. 2000. P.171–180. 164.
Yim M., Duff D., Roufas K. Polybot: A modular reconfigurable robot // ICRA.
2000. P.514-520. 165.
Aldakhilallah K. A., Ramesh R. Recognition of minimal feature covers of
prismatic objects: a prelude to automated process planning // International Journal of Production Research. 1997. V.35. P.635-650. 166.
Reif J., Slee S. Asymptotically Optimal Kinodynamic Motion Planning for
Modular Self-Reconfigurable Robots // International Journal of Computational Geometry & Applications. 2008.
203
167.
Barraquand
J., Latombe J.C. Nonholonomic multibody mobile robots:
Controllability and motion planning in the presence of obstacles // Algorithmica. 1993. V.10. P.121–155. 168.
Boissonnat J.D., Bui X.N. Accessibility Region for a Car that Only Moves
Forwards along Optimal Paths // Technical report, INRIA, Sophia Antipolis, France, 1994. 169.
Boissonnat J.D., Cerezo A., Leblond J. Shortest paths of bounded curvature in the
plane // Proceedings of the IEEE International Conference on Robotics and Automation. Nice, France, 1992. P.2315–2320. 170.
Boissonnat J.D., Cerezo A., Leblond J. A Note on Shortest Paths in the Plane
Subject to a Constraint on the Derivative of the Curvature // Technical report, INRIA, Sophia Antipolis, France, 1994. 171.
Bui X.N., Boissonnat J.D., Soueres P., Laumond J.P. Shortest path synthesis for
Dubins non-holonomic robot // Proceedings of the IEEE International Conference on Robotics and Automation. San Diego, CA, 1994. P.2–7. 172.
Canny J. Some algebraic and geometric configuration in PSPACE // Proc. Annual
ACM Sympos. TheoryComput. 1988. V.20. P.460–467. 173.
Fraichard T. Smooth trajectory planning for a car in a structured world //
Proceedings of the IEEE International Conference on Robotics and Automation. Sacramento, CA, 1991. P.2–7. 174.
Jacobs P., Laumond J.P., Taix M. Efficient motion planners for nonholonomic
mobile robots // Proceedings of the IEEE/RSJ International Workshop on Intelligent Robots and Systems. Osaka, Japan, 1991. P.1229–1235. 175.
Kostov V.P., Degtiariova-Kostova E.V. Suboptimal Paths in the Problem of a
Planar Motion with Bounded Derivative of the Curvature // Technical report, INRIA, Cedex, France, 1993. 176.
Kostov V.P., Degtiariova-Kostova E.V. The Planar Motion with Bounded
Derivative of the Curvature and Its Suboptimal Paths, Technical report, INRIA, Cedex, France, 1994.
204
177.
Latombe J.C. A fast path-planner for a car-like indoor mobile robot // Proceedings
of the Ninth National Conference on Artificial Intelligence. Anaheim, CA, 1991. P.659–665. 178.
Laumond J.P. Finding collision free smooth trajectories for a nonholonomic
mobile robot // Proc. Internat. Joint Conf. Artificial Intelligence. 1987. V.10. P.1120– 1123. 179.
Laumond J.P., Simeon T. Motion Planning for a Two Degrees of Freedom Mobile
Robot with Towing // Technical report, LAAS/CNRS, LAAS, Toulouse, France, 1989. 180.
Laumond J.P., Taix M., Jacobs P. A motion planner for car-like robots based on a
global/local approach // Proc. IEEE/RSJ International Workshop on Intelligent Robots and Systems. Tsuchira, Japan, 1990. P.765–773. 181.
Nakamura Y., Mukherjee R. Nonholonomic path planning and automation //
Proceedings of the IEEE International Conference on Robotics and Automation. Scottsdale, AZ, 1989. P.1050–1055. 182.
Reif J. Complexity of the generalized movers problem // J. Hopcroft, J. Schwartz,
and M. Sharir, Eds. Planning, Geometryand Complexity of Robot Motion. Ablex, Norwood, NJ, 1987. P.267–281. 183.
Schwartz J.T., Sharir M. Algorithmic motion planning in robotics // J. V.
Leeuwen, ed. Algorithms and Complexity. Handbook of Theoretical Computer Science, Vol. A, Elsevier, Amsterdam, 1990. P.391–430. 184.
Wilfong G. Motion planning for an autonomous vehicle // Proceedings of the
IEEE International Conference on Robotics and Automation, 1988. P.529–533. 185.
Wilfong G. Shortest paths for autonomous vehicles // Proceedings of the IEEE
International Conference on Robotics and Automation, 1989. P.15–20. 186.
Amato N.M., Bayazit O.B., Dale L.K., Jones C., Vallejo D. OBPRM: An obstacle-
based PRM for 3D workspaces // Proc. 3rd Workshop Algorithmic Found. Robot., 1998. P.155–168. 187.
Amato N.M., Dill K.A., Song G. Using motion planning to map protein folding
landscapes and analyze folding kinetics of known native structures // Proc. 6th Annu. Int. Conf. Computat. Biol., 2002. P.2–11.
205
188.
Apaydin M.S., Brutlag D.L., Guestrin C., Hsu D., Latombe J.-C. Stochastic
roadmap simulation: An efficient representation and algorithm for analyzing molecular motion // Proc. 6th Annu. Int. Conf. Computat. Biol., 2002. P.12–21. 189.
Barraquand J., Kavraki L.E., Latombe J.-C., Li T., Motwani R., Raghavan P.
Arandom sampling scheme for path planning // Int. J. Robot. Res. 1997. V.16. N6. P.759–774. 190.
Bohlin R., Kavraki L.E. Path planning using lazy PRM // Proc. IEEE Int. Conf.
Robot. Autom., 2000. P.521–528. 191.
Boor V., Overmars M.H., van der Stappen A.F. The Gaussian sampling strategy
for probabilistic roadmap planners // Proc. IEEE Int. Conf. Robot. Autom., 1999. P.1018–1023. 192.
Chang H., Li T.-Y. Assembly maintainability study with motion planning // Proc.
IEEE Int. Conf. Robot. Autom., 1995. P.1012–1019. 193.
Dale L.K., Amato N.M. Probabilistic roadmaps—Putting it all together // Proc.
IEEE Int. Conf. Robot. Autom., 2001. P.1940–1947. 194.
Foskey M., Garber M., Lin M.C., Manocha D. A Voronoi-based hybrid motion
planner // Proc. IEEE/RSJ Int. Conf. Intell. Robots Syst., 2001. P.55–60. 195.
Hsu D., Latombe J.-C., Motwani R. Path planning in expansive configuration
spaces // Int. J. Computat. Geom. Applic. 1999. V.9. N4–5. P.495–512. 196.
Kavraki L.E., Svestka P., Latombe J.-C., Overmars M.H. Probabilistic roadmaps
for path planning in high-dimensional configuration spaces // IEEE Trans. Robot. Autom. 1996. V.12. N4. P.566–580. 197.
LaValle S.M., Kuffner J.J. Randomized kinodynamic planning // Int. J. Robot.
Res. 2001. V.20. N5. P.278–400. 198.
Lindemann S.R., LaValle S.M. Incremental low-discrepancy lattice methods for
motion planning // Proc. IEEE Int. Conf. Robot. Autom., 2003. P.2920–2927. 199.
Nissoux C., Simeon T., Laumond J.-P. Visibility-based probabilistic roadmaps //
Proc. IEEE/RSJ Int. Conf. Intell. Robots Syst., 1999. P.1316–1321. 200.
Reif J.H. Complexity of the mover‘s problem and generalizations // Proc. 20th
IEEE Symp. Found. Computer Sci., 1979. P.421–427.
206
201.
Reif J.H., Sun Z. On frictional mechanical systems and their computational power
// SIAM J. Comput. 2003. V.32. N6. P.1449–1474. 202.
Sellen J. Lower bounds for geometrical and physical problems // SIAM J. Comput.
1996. V.25. N6. P.1231–1253. 203.
Simeon T., Laumond J.-P., Geem C., Cortes J. Computer-aided motion: Move3D
within MOLOG // Proc. IEEE Int. Conf. Robot. Autom., 2001. P.1494–1499. 204.
Singh A.P., Latombe J.-C., Brutlag D.L. A motion planning approach to flexible
ligand binding // Proc. 7th Int. Conf. Intell. Syst. Molecular Biol., 1999. P.252–261. 205.
Berra P. B., Barash M. M. The automated planning and optimization of
manufacturing processes // Proc. 1968 IFAC Symposium on Optimal Systems Planning. New York, NY, USA, 1968. P.191-202. 206.
Berra P. B., Barash M. M. A computerised algorithm for the planning and
optimisation of a manufacturing process // Computer Aided Design. 1971. V.3. P.2428. 207.
Fatikow S., Mounassypov R. Assembly sequence planning for manufacturing by
microrobots // Proc. 1997 IEEE International Symposium on Assembly and Task Planning (ISATP'97): Towards Flexible and Agile Assembly and Manufacturing. New York, NY, USA, 1997. P.269-274. 208.
Kandikjan T., Dukovski V. Automated planning and evaluation of product
assembly sequences // Proc. ThirtyFirst International MATADOR CONFERENCE. San Mateo, CA, USA, 1995. P.541-548. 209.
Gilbert J. Declarative knowledge representation in planning and scheduling //
Proc. Third International Conference on Knowledge Representation (KR'92): Principles of Knowledge Representation and Reasoning. San Mateo, CA, USA, 1992. P.3-13. 210.
Shanahan M. Robotics and the common sense informatic situation // Wahlster W.,
editor. Proc. European Conference on Artificial Intelligence. John Wiley and Sons, Ltd, 1996. P.684-688. 211.
Sormaz D. N., Khoshnevis B. Knowledge representation for automated process
planning // Proc. IEEE International Symposium on Assembly and Task Planning. Los Alamitos, CA, USA, 1995. P.34-39.
207
212.
Beer R., Chiel H., Sterling L. Designing Autonomous Agents: Theory and practice
from biology to engineering and back. The MIT Press/Bradford Books, Cambridge, MA, 1992. 213.
Brooks R. A. A robust layered control system for a mobile robot // IEEE Journal
of Robotics and Automation, RA2, 1986. 214.
Chapman D. Vision, instruction and action. The MIT Press, Cambridge, MA,
1992. 215.
Connell J. Minimalist mobile robotics: a colonystyle architecture for an artifical
creature. Academic Press, Sand Diego, 1990. 216.
Kelly I. D., Keating D. A. Flocking by the fusion of sonar and active infrared
sensors on physical autonomous mobile robots // Proc. Mechatronics. 1996. V.96. 217.
MacLeod E. N., Chiarella M. Navigation and control breakthrough for automated
mobility // Proc. SPIE: The International Society for Optical Engineering. SPIE, 1994. P.57-68. 218.
Merkle R. A proposed ''metabolism'' for a hydrocarbon assembler //
Nanotechnology. 1997. V.8. P.149-162. 219.
Payton D. W., Keirsey D., Krozel D., Rosenblatt K. Do whatever works: a robust
approach to faulttolerant autonomous control // J. Applied Intelligence. 1992. V.3. P.225. 220.
Hunter L. Artificial intelligence and molecular biology. The MIT Press,
Cambridge: Massachusetts, 1993. 221.
Musgrave C. B., Perry J. K., Merkle R. C., Goddard W. A. Theoretical studies of a
hydrogen abstraction tool for nanotechnology. Abstract // Nanotechnology. 1991. V.2. P.187-195. 222.
Ratanapan K., Dagli C.H. An objectbased evolutionary algorithm: the nesting
solution // Proc. 1998 IEEE World Congress on Computational Intelligence. Anchorage: Alaska, May 1998. P.581-586. 223.
Shankar R. Principles of quantum mechanics. Plenum Press: New York,
California: USA, 2nd edition edition, 1994.
208
224.
Villarrubia J. S. Algorithms for Scanned Probe Microscope Image Simulation,
Surface Reconstruction, and Tip Estimation // J. Res. Natl. Inst. Stand. Technol. 1997. V.102. P.425-454.
209
Заключение Исследования в области ДНК наномеханических устройств уже сейчас – на этапе разработки таких устройств – требуют активного участия информационных технологий, причем не только как вспомогательного инструмента, но и как источника моделей, архитектурных решений, структур данных, протоколов и т.д. В обозримом будущем ДНК наномеханические устройства имеют неплохие шансы приобрести статус
промышленных
разработок,
что
поставит
перед
информационными
технологиями стандартный комплекс эксплуатационных задач. При этом следует отметить, что как и у любой области нанотехнологий, у ДНК наномеханических устройств весьма высока «плата за вход»: необходимы знания по широким облостям молекулярной биологии, физеологии, физики, химии, математики, материаловедения (не
считая
информатики).
Поэтому эта
область
исследований
нуждается
в
заблаговременном строительстве информационно-технологического фундамента. В статье дан обзор современного состояния исследований в области ДНК наномеханических устройств. В частности, обозначены основные тенденции в области разработки устройств с использованием генетического материала. Представлен краткий обзор по материалам и узлам, используемым для конструирования наномеханических устройств. Дан краткий обзор разработанных на сегодняшний день моделей нанороботов. Представлен обзор по компьютерному моделированию биологических наноматериалов, наноустройств и их отдельных узлов на этапе разработки; компьютерным симуляторам работы наноустройств и поведения наноматериалов. Рассмотрены модели управление наносистемами. Дан анализ переносимости систем управления традиционными робототехническими комплексами на наносистемы. Рассмотрены
также
исследований
и
вопросы
позволяющие
из
смежных
судить
о
дальнейших
исследований по наномеханическим устройствам.
210
областей,
дополняющие
картину
перспективах
развития